Microarray Probes on PGSC0003DMT400080319

Probe IDChipProbe Sequence
CUST_48676_PI426222305 JHI_St_60k_v1 TGCTTTTTAGCACTGAGCAGTAGTTCCTGTGTTGGTAAATTTTGACTGATGAATCACAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080319

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080319 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G14790.1 +1 0.0 1290 680/1103 (62%) RNA-dependent RNA polymerase 1 | chr1:5094317-5097817 REVERSE LENGTH=1107

Transcript Sequence (3825 bp)

>PGSC0003DMT400080319 3825 pgsc_dm_v3.4
GAAATATTCTTTACTTAGTTCACTAGGGATTGACTCAACACTCCCCCCTCCCCTCAAGTC
TTCGTGTGTTGTGTAAATAAATTTGGTTGTCCTTCAGTTTCTGGCACTACTACTGGGTAG
TTTTATTTTTGCATAACTTCAGGAGGTATTCCAGTTGGTGATTAGCATTTGAACGTCGAA
CTGCACTTGGAATTTGGCTACATGGGAAAGACAATTCAGGTTTATGGATTCCCTGATCTT
CTGTCTGCAGAAGTGGTCAAATCATTCTTAGAGAAACATACAGGATATGGAACTGTATGT
GCATTGGAGGTTAAACAGTCCAAAGGAGGATCTAGAGCATTTGCCAAAGTTCAATTTGTC
GACAACATTAGTGCTGACAAAATCATCAATTTGGCTAGTAAGAGGCTGTATTTTGGCTCT
TCTTATTTGAAGGCTTGGGAAATGAAAACTGATATTGTCCAATTGCGGGCGTATGTGGAT
CACATGGATGGCATAACTTTGAATTTCGGATGTCAGATATCAGATGACAAGTTTGCAGTG
TTGGGAAGTACAGAAGTTTCAATTAAATTTGGCATTGGATTGAAGAAATTTTTTTTCTTT
TTATCTAGTGGTTCAGCTGATTATAAACTTCAGCTTTCATATGAAAATATATGGCAGGTT
GTGCTCCATCGTCCATATGGTCAAAATGCTCAGTTTCTCCTCATACAGTTATTTGGTGCT
CCTCGGATCTATAAGAGACTTGAAAACTCCTGTTATAGCTTCTTTAAGGAAACTCCTGAT
GATCAGTGGGTGAGGACGACAGATTTCGCTCCATCTTGGATAGGGCTGTCTTCTAGCTTA
TGTTTGCAGTTCCGTAGGGGTGTTCATCTTCCAAATTTCCAGGAAAGTTTTTTTCACTAT
GCAGAACGTGAAAACAATATTACTTTACAGACTGGTTTCACCTTTTTCGTCTCTCAAAAA
TCGGCTCTGGTTCCCAATGTCCAGCCTCCGGAAGGAATTGCAATTCCCTACAAGATATTG
TTCAAAATTAGTTCTTTGGTACAGCATGGATGCATTCCTGGGCCAGCATTAAATGTCAAC
TTTTTCCGATTAGTTGATCCTCAAAGGAGAAATGTTGCATGCATTGAGCAAGCCTTAGAG
AAACTGTACTATTTGAAGGAGTGCTGTTATGATCCAGTGAGGTGGCTGACTGAGCAGTAT
GATGGGTATCTCAAGGGTAGACAACCTCCAAAATCTCCGTCCATCAATTTAGATGATGGG
TTAGTGTATGTAAGAAGGGTCCTAGTAACACCATGCAAAGTTTATTTTTGTGGTCCAGAG
GTTAATGTTTCCAATCGGGTTCTCCGCAATTATTCTGAAGACATAGATAACTTTCTTCGT
GTTTCTTTTGTTGATGAGGAGTGGGAGAAACTGTATTCTACAGACTTATTACCAAAAGCA
AGTACTGGAAATGGTATCAGGACAAACATCTATGTGAGGATCCTATCAACTCTGCAGAAA
GGCTTTGTAATTGGTGATAAAAAATTTGAATTTCTTGCATTTTCATCGAGCCAGTTGCGG
GATAATTCAGTGTGGATGTTTGCATCAAGACCTGGCCTTACTGCAATTGATATAAGAACT
TGGATGGGTGATTTTTCGCAGATCAAGAATGTGGCAAAATATGCTGCCAGACTTGGTCAA
TCTTTTGGTTCCTCCAAAGAGACTTTGAGTGTTCTTAGGCATGAGATTGAAATTATTCCT
GACGTAAAGGTTCATGGAACCAGCTATGTCTTTTCTGATGGAATTGGTAAAATATCTGCT
GACTTTGCTCGTAGAGTTGCCTCAAAATGTGGCCTTCAATATACACCATCTGCTTTTCAG
ATTCGTTATGGTGGATATAAAGGTGTTGTGGCTGTTGATCCATATTCATCAATGAAGTTA
TCTTTGAGAAAGAGCATGTCGAAATATGAATCAGACAACAATAAGTTAGATGTCCTTGAG
TGGAGCAAATATCAGCCTTGTTTTCTTAATCGTCAACTGGTTACTCTCTTGTCTACACTT
GGAGTGAAAGATGATGTTCTCGAACAGAAGCAAAAGGAAGCTGTAGATCAGCTTGATGCT
ATCTTGCATGATTCTTTGAAGGCACAGGAGGCTTTGGAATTGATGTCTCCTGGAGAAAAC
ACTAATATTCTCAAGGCAATGCTAAATTGTGGTTATATGCCTGATGCTGAGCCCTTTCTT
TCAATGATGCTGCAAACCTTCCGCGCATCGAAGTTGCTCGATTTGCGGACTAGATCAAGA
ATATTTATTCCAAATGGAAGAGCAATGATGGGATGTTTGGATGAATCCAGAACCTTGGAA
TATGGTCAGGTGTTTGTTCAGTTTACTGGTTCTGGACATAGAGAATTTTCTGAGGATTTA
CATCCATTTAATAACAGCAGATCCACCAACTGTAATTTCATTCTCAAGGGAAATGTGGTT
GTTGCAAAAAATCCATGCTTGCATCCTGGTGATATTCGTGTTTTAAGGGCTGTAGATGTT
CCAGCGCTGCACCACATGGTAGATTGTGTTGTATTCCCCCAGAAAGGAAAAAGACCTCAT
CCGAATGAATGTTCTGGGAGTGATTTGGATGGAGATATCTACTTTGTTTGCTGGGATCAA
GACATGATTCCGCCAAGGCAAGTCCAAGCGATGGAATATCCTCCAGCACCCAGCATACAG
TTGGATCATGATGTCACAATTGAGGAAGTTGAAGAGTACTTCACCAACTATATTGTGAAT
GACAGTTTGGGAATCATAGCAAATGCCCATGTCGTATTTGCAGACAGAGAACCTGATATG
GCCATGAGTGATCCATGCAAAAAACTTGCTGAGCTCTTTTCAATTGCAGTGGACTTTCCA
AAGACTGGTGTTCCTGCTGAAATACCATCTCAGTTGCGCCCTAAAGAATACCCAGACTTC
ATGGATAAGCCGCCAGACAAGACAACCTATATCTCAGAAAGAGTTATTGGAAAGCTTTAC
AGGAAAGTGAAGGACAAAGCTCCTCAGGCTAGCTCTACTGCGATATTCACAAGGGATGTT
GCAAGGAGATCATATGATGCTGATTTGGAAGTTGATGGATTTGAAGATTACATTGACGAA
GCTTTTGACTACAAAACTGAATATGACAACAAGCTGGGTAATTTAATGGACTACTATGGC
ATAAAAACGGAGGCTGAAATACTTAGTGGTGGCATCATGAAGACATCAAAAACTTTTGAT
CGCAGAAAAGATGCTGAGGCCATTAGTATTGCTGTGAGGGCCTTGAGGAAGGAAGCAAGG
ACCTGGTTCAAGAGGCGTAATGATATAGATGACATGTTACCAAAGGCTTCGGCTTGGTAC
CACGTTACATATCATCCTACATATTGGGGTTGCTACAATCAGGGGTTGAAAAGAGATCAT
TTCATTAGCTTTCCCTGGTGTGTTTATGACCAGCTAATCCAGATTAAGAAGGAGAAAGCA
CTTAACAGGCCAGTTCTCAATTTGTCATCTCTCAGGGCTCAGCTGAGTCACAAATTAGTG
TTGAAATGAGATTTCAGTCAAGCGTTAAGCTGATATATATATATATATATAAATGTAATA
GGGGTGTGATCATAAGAAAACTGCTATGCGTTGTTAACAACCTTTTGTATTCAAAACTGC
ATGAACCTGTAACATATATGCAGTATCTTAGAAACTGCTGTACAGCTAAGTACTAATATG
TATGTGGTTTGAGTTTTATCTCTCTTCTCAACATAGTTCATATTATGCTTTTTAGCACTG
AGCAGTAGTTCCTGTGTTGGTAAATTTTGACTGATGAATCACAAA