Microarray Probes on PGSC0003DMT400079708

Probe IDChipProbe Sequence
CUST_45524_PI426222305 JHI_St_60k_v1 CCCTCTCTGCGTCATCTTTGAATTTCACGTGCAATAATATTTGAAATCTACACCTATTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079708

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079708 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G17330.1 +2 1e-50 181 95/174 (55%) glutamate decarboxylase | chr5:5711141-5714839 FORWARD LENGTH=502

Transcript Sequence (1359 bp)

>PGSC0003DMT400079708 1359 pgsc_dm_v3.4
TCGTGTGGATGTTAGCTTTAATGCTGTCTCCCAATTTCAGGTTCCTATCAAATAATTGCG
CAGTATTATCAGTTAATAAGGCTTGGCTTTGAGGTAATTACCGAAATCACATTAAACACG
ACTCTGTGTTTCTTCAAGTCTGAACAACAATTGCCTGGATTATATTATTTAATATAAGTC
GACAGCTGCCTCTTGCAGATAGATTGCGTACAATAGACCCTTGTGGTCCGGCCTTGCGGG
AGCTTTAGTAAACTGGGCTGTCCCTTATTTCTACACTGCCCTTTTTTCTATTATATTAGT
TGTTAATATAAGTCGAAAGCTGAGTCTCTTAAGGGGTATTTTTAGATCTTATATTGTGCT
TGCTTTGATTATGCAGAACACCTTTGAATTTAGAACACATTTTACTCATAAAGAGTCATG
GAGTAAAACAGTGGAATATTTAGATGATGTTTGTCAACAGCTATGTTCCTTCTGAATTCT
GAGGTGGTTGATAATTCATTTTGTGCAACAAAGTAAACCTGCCATTAATCGTATTGCTTA
AGCACGATACAAATGATTTACACTTTTGCTTCTGGTCTGCAAGGGTTATAAGGACGTCAT
GGAGAATTGCTTAGCAAATACAAAAGTACTAACAGAGGGAATCACAAAAATGGGGCGGTT
CGATATTGTCTCTAAGGATGTGGGTGTTCCTGTTGTAGCATTTTCTCTCAGGGACAGTAG
CAAATATACAGTATTTGAAGTGTCCGAGCATCTCAGAAGATTTGGATGGATTGTCCCAGC
ATACACAATGCCACCGGATGCTGAACACATTGCTGTTCTGCGGGTTGTCATTAGAGAGGA
TTTCAGCCACAGCCTAGCTGAGAGACTTGTTTCCGACATTGAGAAAATTCTGACAGAGTT
GGACACACAGCCTTCTCGTTTGCCCACCAAAGCTGTTCGCGTCACTGCAGAGGAAGTGCG
TAATGACAAGGGTGATGGGCTTCATCAGTTTCACATGGATACTGTAGAGACTCAGAAAGA
CATAATCAAGCATTGGAGGAAGATCGCAGGGAAGAAGACCAGCGGAGTCTGCTAGGTCTA
GCCACACTTGTTTTCTGGGCTCCGCTTCCATCGTCATCCTGTAGTATGTATTACGTGTGT
TGTTTCCATCTAATGTAGTAGTTGGTACCGTAATCTGTAAATGCTTTCATGATCTTGGCT
CTGTATATGTTAATAAGCACTGCATTTCAAGTTCCTGTAAGTATTTATGTATGAATCTAT
CCGTCTGCCATAATTGGTAGAATGCCCTCTCTGCGTCATCTTTGAATTTCACGTGCAATA
ATATTTGAAATCTACACCTATTATAAATGATGTTTTTTT