Microarray Probes on PGSC0003DMT400079508

Probe IDChipProbe Sequence
CUST_41424_PI426222305 JHI_St_60k_v1 GTCAAATCACTTGGACTTGTTGCAATATGTTAATCTGAATGGGAATGGGTTTTAACAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079508

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079508 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G39070.1 +2 5e-71 229 120/203 (59%) B-box zinc finger family protein | chr4:18205061-18206421 REVERSE LENGTH=242

Transcript Sequence (1454 bp)

>PGSC0003DMT400079508 1454 pgsc_dm_v3.4
TTTGTCTCTTTCCCAAATTTACTCCCTTCTATTCTAAGTTTCTAACTATATATATACATC
TCTTTAGGGAAACAGTACAATTATTAAAAAGAAAAAGAAAATGAAGATTCAATGTGATGT
TTGTGATAAAGAAGAGGCATCAGTTTATTGTTCAGCAGATGAAGCCACACTTTGCCAAAG
CTGTGATTATCAAGTGCATCATGCCAACAAGCTTGCAAGCAAACATCTTCGTTTTTCTCT
AATTCATCCTTCTTTCAAAGATTCTCCTCTTTGTGACATTTGCCAGGAAAGACGTGCACT
GCTATTTTGTAAAGAAGATAGAGCAATTCTTTGCAAAGAATGTGACTTGCCTATACACAA
AGCAAATGAACATACAAAGAAACACAACAGATTTCTTCTAAGTGGAGTTCAGCTCTCTTC
TGATGTACTTGCTTCTAATTCTAATAACCAAAATTCAATATCCCCAACTGGATCTGCTGC
AAGTAATGCTGGTACAAATAATTTTAAAGCACGTAGTGGTAATTTTGGGATGAAGAGTAA
TTCGATTTCGAGTACTACAGAATCGACACCTAATTATTTTCAAGTTGATTATCATGTACA
AGAGGGTTCTGTTTCAACTAGTAGCATATCAGAATATTTGACTGAGACTCTTCCTGGTTG
GCATGTTGAAGATTTTCTTGAATATCCCTCTTCTTCTTCATATGGTAAGTGTTTCTTTTT
TTTACGGATTTAACTTATATTCACTGACGATAATGATGGTGACACCTTTTGCAGAGGAAT
GTCACAAGACATCGCTACTTTCTCGTTTTATGTGTATAAAAATGCTACAGACCGACACAA
CTCGAAATATGGGATTAAATTATTAACGAAAGGGGCATTTTTAGACCAACTGATGACATA
TTTGACCATTTTTCGAATACAATAAAATGTTCAGAACTTGCAACTAAATGATGCTGTTTG
ATTGCAGAATTTTGATCAGATACGACCAGCTGTGTAGTTTTTTTTCCACTACAGTAAGTG
GGGATACCTCTTAATATCAAATGGAGTACCTGTTCCTCAGATCAACTCTCCATCTACCAA
GCAACTCATAAGACAGACTTGGTAATACTAAAGGGCATAATATCTTTTGAGATATTAAGA
AAACTGTTATACAAATTGCCATCTGACCTTTTCTTTTGGTTGCTAACTTTGACCAGTTGC
TTTGTTTTTGGACATGTAACACATGTTGTAAGTTAAAGCCCCACTGTTCTTTTTTTTGTT
ATTTGTTTTTTTGCAAGTCAAATCACTTGGACTTGTTGCAATATGTTAATCTGAATGGGA
ATGGGTTTTAACAGATCTGGGGTACTTTTTGTTTTGCTTTGTGGGAGACCAATCTTTTTG
TAATGCTAGTGGGATAGCCTTGTGCCTATTACCCGCTTTGATTATTGAATATGGTATTCC
TATTTGTTTCAAGT