Probe CUST_41424_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_41424_PI426222305 JHI_St_60k_v1 DMT400079508 GTCAAATCACTTGGACTTGTTGCAATATGTTAATCTGAATGGGAATGGGTTTTAACAGAT

All Microarray Probes Designed to Gene DMG400030958

Probe IDChip nameTranscript IDProbe Sequence
CUST_41381_PI426222305 JHI_St_60k_v1 DMT400079507 CTCTTCTTCTTCATATGATGAAGATTCAATGTGATGTTTGTGATAAAGAAGAGGCATCAG
CUST_41424_PI426222305 JHI_St_60k_v1 DMT400079508 GTCAAATCACTTGGACTTGTTGCAATATGTTAATCTGAATGGGAATGGGTTTTAACAGAT


Microarray Signals from CUST_41424_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h21.47393.56610.6727170.113022
ABA 1h10.06973.146260.3425230.128091
ACC 1h19.45737.459270.4953690.314869
BABA 1h44.34899.403721.412470.188957
Chitin 1h61.06258.73612.137340.514202
Epi 1h40.38413.969891.4950.146862
SA 1h38.10423.900731.180710.14945
Me-JA 1h48.89214.879521.907250.17272
Control 6h35.187214.37660.8061190.623059
ABA 6h9.277053.687050.2729940.114158
ACC 6h53.64445.25361.491260.184733
BABA 6h45.582115.63431.167130.409095
Chitin 6h19.7567.609880.5182620.208809
Epi 6h20.18534.130690.567230.125086
SA 6h13.91553.764740.4258110.13217
Me-JA 6h42.055115.48671.174350.384898

Source Transcript PGSC0003DMT400079508 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G39070.1 +2 5e-71 229 120/203 (59%) B-box zinc finger family protein | chr4:18205061-18206421 REVERSE LENGTH=242

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079508

Click here to view details at Spud DB Genome Browser (opens in new window)