Microarray Probes on PGSC0003DMT400073540

Probe IDChipProbe Sequence
CUST_40747_PI426222305 JHI_St_60k_v1 CGGCGCAGAGAGAGAGAAGAGAAGAATCAGTTACCTAAATTTCTGAAATGAATACAGTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073540

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073540 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54740.1 +3 6e-21 92 54/121 (45%) Protein of unknown function (DUF3049) | chr1:20430839-20431738 FORWARD LENGTH=299

Transcript Sequence (1222 bp)

>PGSC0003DMT400073540 1222 pgsc_dm_v3.4
TTTTAGGAAAAAAAATCTCAAAGCCCTTATATATATATCCAAATCTTCCAAGCTAAGCCT
CAAAAGCATACTATTATATGATGACGAGCTTTTGCAGTGAAAAAGTCCATCCTTTCTTGT
GTTTATCAAATTCCAAACACAATGGAACACTTCTAGACTCTTCTCTCCCCCGCCTAAATA
TTTTCACCGCCGCTTCAATCGACAGCGACAACTTTGACCCTCAAAACACAACCAATTACT
CCATGACACCGCCAGCCGCCGCAGCGAAAAAGGATCCCGGCGGAATTGGGTTCTTAGACG
AAGTTGGAGGGAGTGTTGATGGATTAATGTCTTGTACAGAGAGTCTCGGTTTCGAGAGCT
CCGATGAGAGGACAGTAGATGATCAAATTGAGGATCTAGGTTATCGTGACGAATTAGCTT
TGTTGTCTAGGAAATCAAATTGTAGCAATAATAATACGGCTAGTACTAATTCAAGGTGCT
GGCAAAGAAGTAATTTGGGGGAGAAGAAAGAAAAGAAGGAGTTTCCACCGCCATTATCGT
CATTAAGTCAAGATGGAAAGCCCAACTTCTTCATGCGTGCGGTGAGGAAAGATGGACGGT
TAGAATTGACAGAGGTGAAAATTGATCGGCCCAAAACTTTCCGTGCTTCCCGCCAAGATG
GACGGTTGAGATTGCATCTAATTCGCGATCTCGAAGAAGAAGAAGAAGAAGATTTTGCCG
TGGAAACAGAGGAAGACGTAGAGGAAGAAGAAGAAGAAGATATTGAAGAGTGGAGGTTTC
CGGTGACGGGAAGTGGAATTGGAGATAGTCATCGGAGATGTTACGGCGACCATGGTAATA
ACCACCACCATCACGACCGTAATTTACATTTGTGGAGGCAACGGTGTGTGACAACTAGGT
GAATGTGAATCTGTTTTTCGTTCAACTACGTACTCTGCCATTTGCAAGGGAATCTAAAAA
AAAATAAAACTGAAAAACTGAGGACCCAATGAAGTTGGAATTAAGAATCTGCAGCGGCAG
CCACTGAAATTAAGAACCTTGAATTGCGCTAGCAGTTGGAAAAAAGCATCGGGATTCTGT
TTTGCAACAGAGCAGTATCGGCGCAGAGAGAGAGAAGAGAAGAATCAGTTACCTAAATTT
CTGAAATGAATACAGTATAAAAAAAATCAAGAATTATTTTTAGTTATCTTGTCATTTCAT
TAATGGTAAATAGAATAAAAAA