Probe CUST_40747_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_40747_PI426222305 JHI_St_60k_v1 DMT400073540 CGGCGCAGAGAGAGAGAAGAGAAGAATCAGTTACCTAAATTTCTGAAATGAATACAGTAT

All Microarray Probes Designed to Gene DMG400028568

Probe IDChip nameTranscript IDProbe Sequence
CUST_40747_PI426222305 JHI_St_60k_v1 DMT400073540 CGGCGCAGAGAGAGAGAAGAGAAGAATCAGTTACCTAAATTTCTGAAATGAATACAGTAT


Microarray Signals from CUST_40747_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1396.64102.1122.138870.123578
ABA 1h2271.53295.313.888160.486657
ACC 1h1137.87178.9611.66190.171737
BABA 1h902.355209.2881.346670.232432
Chitin 1h947.923153.7441.583720.151668
Epi 1h798.706136.9881.375460.247147
SA 1h721.011105.9411.058480.088765
Me-JA 1h525.24936.58630.985520.0571938
Control 6h529.9685.84780.7909750.0764297
ABA 6h2293.27228.9793.285250.189733
ACC 6h345.27247.7430.4537710.0720123
BABA 6h336.92468.03380.442140.11505
Chitin 6h481.52528.06330.6950170.0404358
Epi 6h374.78621.9760.510720.0492204
SA 6h484.82728.2170.7536340.067323
Me-JA 6h811.489243.9081.152810.290377

Source Transcript PGSC0003DMT400073540 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54740.1 +3 6e-21 92 54/121 (45%) Protein of unknown function (DUF3049) | chr1:20430839-20431738 FORWARD LENGTH=299

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073540

Click here to view details at Spud DB Genome Browser (opens in new window)