Microarray Probes on PGSC0003DMT400071770

Probe IDChipProbe Sequence
CUST_49188_PI426222305 JHI_St_60k_v1 CAGCAACGCCTTTTCTCTACCGGAAATACAATGTATAGTCTTACTCTAGTTTTCCTCTCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071770

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071770 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G10170.1 +1 0.0 919 460/509 (90%) myo-inositol-1-phosphate synthase 3 | chr5:3187538-3190161 REVERSE LENGTH=510

Transcript Sequence (1929 bp)

>PGSC0003DMT400071770 1929 pgsc_dm_v3.4
GCCTTAAAGAATATACTTTTGAGTGTCTTCTCCATTTTTTTTTGGTCAAAAAAAAAAAAA
AGTTTCACTTTTTTGTGTTTGTGAGTGAAAATGTTTATTGAGAACTTTAAGGTTGAGAGC
CCCAATGTTAAGTACACAGAGAGTGAGATTCACTCTGTGTATGATTATCAAACAACTGAG
TTAGTTCATGAGGAAAAAAATGGGACATTTCAATGGACTGTTAAGCCAAAAACTGTTAAA
TATGAATTCAAGACTGATGTTCATGTTCCAAAATTAGGGGTTATGCTTGTTGGATGGGGT
GGAAACAATGGTTCAGCCTTGACTGGAGGTGTTATTGCTAACAGAGAAGGAATTTCATGG
GCTACCAAGGATAAAGTGCAGCAAGCCAATTACTTTGGCTCTCTTACACAGGCCTCTACT
ATTCGAGTTGGTTCCTTCAATGGAGAGGAGATCTATGCCCCCTTTAAGAGCATACTTCCC
ATGGTCAATCCAGATGATGTAGTGTTTGGAGGATGGGACATCAGCAACATGAATTTGGCA
GATGCCATGGCAAGGGCTAAAGTTTTTGACATTGATCTTCAAAAGCAGCTGAGGCCCTAC
ATGGAATCCATGGTCCCACTGCCTGGTATCTATGACCCTGATTTCATTGCTGCAAACCAA
GGCTCACGTGCTAACAATGTCATTAAAGGAACCAAGAAAGAACAAATTGATCAAATCATT
AAGGATATTAGGGAGTTTAAGGAGAACAACAAAGTGGACAAGGTGGTGGTTTTGTGGACT
GCTAACACTGAAAGATACAGCAGTGTGGCTGTTGGCCTTAATGATACCATGGAAAACCTC
TTTGCTTCTGTGGATAGAAATGAGGCTGAAATATCTCCTTCCACCTTGTATGCTATTGCT
TGTATTCTTGAAAATGTGCCCTTCATCAATGGAAGCCCACAAAACACTTTTGTCCCAGGC
CTCATTGATTTGGCCATCAAGAGGAACACTTTGATTGGTGGTGATGACTTTAAGAGTGGT
CAAACCAAGATGAAGTCAGTGCTGGTTGATTTCCTTGTTGGAGCTGGTATTAAGCCAACA
TCAATTGTGAGCTACAACCATTTGGGTAACAATGATGGAATGAATCTGTCGGCCCCTCAG
ACTTTCCGCTCAAAGGAGATCTCGAAAAGCAATGTTGTCGATGACATGGTTTCTAGTAAT
GCCATCCTTTATGAGCCTGGAGAGCACCCTGACCATGTTGTTGTGATTAAGTATGTACCA
TATGTGGGAGATAGCAAGAGGGCAATGGATGAGTACACATCAGAGATTTTCATGGGTGGA
AGGAACACCATTGTATTGCACAATACCTGTGAGGATTCTCTTTTGGCTGCTCCAATTATC
TTGGATTTGGTCCTCCTTGCTGAACTCAGCACCCGCATTCAGCTTAAAGCTGAAGGAGAG
GGTAAGTTCCACTCCTTCCATCCCGTGGCGACCATCCTCAGCTATCTTACCAAGGCTCCT
CTGGTACCACCAGGTACACCAGTGGTGAATGCCCTTTCAAAGCAGAGGGCAATGCTTGAG
AACATATTGAGGGCTTGTGTTGGACTGGCACCAGAGAACAACATGATATTGGAATACAAA
TGAAGATCTCATAAGAAGTGAAAGGACTCAAGAAGCCGTGTAGCAGAAGAACCATGTTGT
CTTTCTTTACTTTTATTTTTGTAATCTTTTGTCTCATCATTAGTACTATAATTAGCTAAA
TCTCAGCCAACCCTTGGAGGTATAGCTGTTGTTTAATGGCGGGCTAAGTTGAATGTCATT
ATGATTTCTTTGTGTATTAGGCCTTCATTTTGAAGATGTATTATCAGTGTTGTCTTAGCT
CTTTAGAGCCAGCAACGCCTTTTCTCTACCGGAAATACAATGTATAGTCTTACTCTAGTT
TTCCTCTCG