Probe CUST_49188_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_49188_PI426222305 | JHI_St_60k_v1 | DMT400071770 | CAGCAACGCCTTTTCTCTACCGGAAATACAATGTATAGTCTTACTCTAGTTTTCCTCTCG |
All Microarray Probes Designed to Gene DMG400027916
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_49188_PI426222305 | JHI_St_60k_v1 | DMT400071770 | CAGCAACGCCTTTTCTCTACCGGAAATACAATGTATAGTCTTACTCTAGTTTTCCTCTCG |
Microarray Signals from CUST_49188_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 55562.4 | 5949.84 | 1.76437 | 0.101866 |
| ABA 1h | 56195.5 | 4085.13 | 2.02889 | 0.280261 |
| ACC 1h | 44034.2 | 5381.13 | 1.35397 | 0.0781718 |
| BABA 1h | 32256 | 5332.61 | 1.04549 | 0.100009 |
| Chitin 1h | 32753.8 | 2527.67 | 1.16227 | 0.0913557 |
| Epi 1h | 31961.1 | 2194.29 | 1.17949 | 0.0680979 |
| SA 1h | 41770.6 | 3140.31 | 1.29812 | 0.108803 |
| Me-JA 1h | 27210.3 | 1871.46 | 1.06503 | 0.1195 |
| Control 6h | 12814.7 | 2345.25 | 0.395606 | 0.0475563 |
| ABA 6h | 130505 | 7999.45 | 3.92541 | 0.232307 |
| ACC 6h | 11740.8 | 3028.18 | 0.308977 | 0.0326211 |
| BABA 6h | 17774.3 | 3633.51 | 0.484249 | 0.137261 |
| Chitin 6h | 20445.2 | 1655.26 | 0.6126 | 0.0588031 |
| Epi 6h | 14018.4 | 809.948 | 0.398796 | 0.0360645 |
| SA 6h | 10665.7 | 1532.44 | 0.339534 | 0.0452076 |
| Me-JA 6h | 5081.54 | 1642.41 | 0.14905 | 0.0355784 |
Source Transcript PGSC0003DMT400071770 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G10170.1 | +1 | 0.0 | 919 | 460/509 (90%) | myo-inositol-1-phosphate synthase 3 | chr5:3187538-3190161 REVERSE LENGTH=510 |