Microarray Probes on PGSC0003DMT400069836

Probe IDChipProbe Sequence
CUST_30347_PI426222305 JHI_St_60k_v1 AGGAGAAGTAGCTGTCCGATTTTTTATTGGTCTTGTTAAAATCCTACCTGCCAAATATGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069836

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069836 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G06440.1 +1 2e-173 510 302/658 (46%) Galactosyltransferase family protein | chr3:1972913-1975272 REVERSE LENGTH=619

Transcript Sequence (1836 bp)

>PGSC0003DMT400069836 1836 pgsc_dm_v3.4
ATGAAGAAGTATTTATTAATTAGAAAAGTGGGAAGGAAGAGATGGGCTGGATGTCTGCTT
ATTATTGGTCTTGCAATGGTTTTGTTGATTCGATATAGTAGTGTAGAAAAATCATACAGC
ATTGTAGAAAAATCAGACAGCAGTGTGGAAGAATCTCCGAAAAAGCAATCAGTTTATGGG
TTTTTCAATGACCATCCGGACATTAATGAAGGTTCAAAAGATGAAAATGCCAAGTTGTCT
GATCTGAAACCAGTAGAGCTAGTAAGTTTTAAGGAAAAACCACATCTTATTGATGTCGAA
GGGCTTAATGATCTATACAGCTTGAATAATTTTTCGACAGAAGAGTCTAAGGCATTGCTA
GCATGGGGCAAGATGAGATTGTTGTTGTCTAGATCAGATGGTTTGAATGGAACTGCTCAA
GGAGTTAAGGAGGCTGCTATATCATGGAAAGATTTGGTGTCGTTCATTGAGAAAAGTAAA
GTTCAAGATGAGAAGGAAAAACAGGATTGTCCTTATTCTGTGACTGCATTCAATACCGCG
ACGTTGAAGGACGGGAGCAGTCTTAGGATCCCTTGTGGCTTAGTTGAGGATTCATCTATT
ACTGTGATAGGCATACCTGATGCAAAACAAGAAGGTTTTCAAATTGAGCTGGTAGGTTCG
AAACTTCCAGAGGAAACAAATCCTCCTATAGTTTTGAATTATAATGTAATTTTACCCGGG
GAGAACTTGACAAAGGATCCCCTTATTACTCAAAATACATGGACTAATGAATCCGGGTGG
GGTAAGGTGGAAAAGTGCCCTGATCATGGCTCTACCGACGTGATAAAAGTTGATGGATTA
GTCAAATGCAATGCCAAAATTTTCCGAAATAATGTAGAAGAAACTGCAAATATGACCAAT
ACCAGCAATCCAAAGTCTTCAGATGTATCAAATTCTAGTGCCTACGGTACTGCCAACTAC
CCTTTTCTTGAAGGTAATCCATTTACTGCAACACTATGGGCTGGTATAGAGGGGTTCCAT
ATGACAGTCAACGGAAGACACGAGACGTCTTTTGCATATAGAGAGAAACTCGAACCTTGG
TTGGTTAGTGGAGTCAATGTGATAGGTGGTGTGGACACCATATCGATCTTAGCGAAAGGA
TTACCTGTGTCCAATGATTTTAACTTGGGTGATGATGTTGAGCACCTCAAAGCTCCATTA
ACTCGTAAAAAGAGACTTGTCATGTTAATTGGGATTTTCTCTACTGGAAACAATTTTGAG
AGACGTATGGCACTAAGGAAATCATGGATGCAATATGAAGCTGTGCGGTCAGGAGAAGTA
GCTGTCCGATTTTTTATTGGTCTTGTTAAAATCCTACCTGCCAAATATGTTATGAAGACT
GATGATGATGCTTTTGTAAGGATTGATGAAGTTCTATCTAGCCTCAAGGGAAAGGATCCT
AATGGTCTATTATATGGTGGAATATCTTTTGAGTCAGCACCCCACAGGGATAAAGAAAAC
AAGTGGTATATCAGTCCTGAGGAATATCCGCCTGCTTCCTATCCCCCATGGGCACATGGA
CCAGGTTATATTATTTCTCGAGATATAGCTAAGTTCATTGTTCAGGGCCATCAAGAAATG
GAACTGATGCTTTTTAAACTTGAGGATGTTGCTGTGGGCATTTGGATTGAGGAATTCAGG
AGGAAGGGTCACAAAATACAGTATGTTAACGATGAAAGGTTTTACAATGCCGGTTGTGAA
TCAGGCTATATTCTTGCACATTATCAGAATTCGAGGATGGTACTATGTCTGTGGGAGAAA
CTGCAGAAAGAACACGAACCAAACTGCTGCGAGTGA