Microarray Probes on PGSC0003DMT400066762

Probe IDChipProbe Sequence
CUST_17738_PI426222305 JHI_St_60k_v1 GGGGTTGTTGTAATATTAATGCTTTATCCAGAGATGTTCTTGTTCGACTTGACATAATAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066762

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066762 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G45380.1 +3 8e-44 161 103/237 (43%) FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: Calcium-binding EF-hand family protein (TAIR:AT4G34070.1); Has 171 Blast hits to 170 proteins in 31 species: Archae - 2; Bacteria - 0; Metazoa - 68; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | chr2:18699588-18703093 REVERSE LENGTH=494

Transcript Sequence (1295 bp)

>PGSC0003DMT400066762 1295 pgsc_dm_v3.4
GAAGGTTCTGAGTTGAAAGAGGAACAGAAAAAGGGAAGAATCTAGACCCCCAACACGTGT
CACTCTCACACCAGCTCCTTTTCAAATACAATTTTTTTTGAATTTCTAGAGTGTGCTGTG
TTGTGAGAATATGCAGAGGGGACAATTTCAACAGTCCATTTGAAAGATTTGGAGGCATAA
TGTCAAGTATATTTGGATTTGGAGGAAGAGACCCATTCGATGATCCATTCTTCTCTCGCC
CGTCTCAGACCTCCATGTTACATCCAACAACTCCTTCTGATGATGAATCTAATAGGCCAG
TCATTCAAGAGATTGATACGGACGAAGATGCACCGCTAGAACCAGATGAGGAGAACGGGG
ACGTGAATGGCTCTAAGAAGAAAAGAGATAGGGCTTATGCTAACAGAAATCCACTTGTTG
AACATCCTGAAGACCTAACTGATGACCATAGCAAGAGCAGCAAGATCATAAGCAAAGATG
TGACTCGTGGAATGAAAGACATGAAATTGGAAGGAACGCAATCGAAGCCTCAGAGCATGA
GCTATAGAAGAGTTACATATGGTGGAATAGACGGGACATATTACACTGCGACCACCTCAC
GGAGGGCTGGAAATGATGGAAGGGTGTTAGAGGAGAGCAAGCAAGCAGATAGCACAACTG
GTCAAGCAACACATAGAATTTCCAGAGGAATTCAGGATAAGGGGCATTCGTTGACAAGGA
AACTTGCCTCAGATGGTAAGGTGGATACAATGCAGACGTTGCATAATCTAGAAGAAGATG
AATTAGCTGGCTTTGAACAGACATGGAATGGCAATGCTAATAACGAAATCCCTGGCTGGA
ATAGTGGATTTGATTTCCACGCGAATGCAGGAACAAGCAGTAATTGGCTGACGAATTGGG
AAGCTGGATTCCGAGATCCATTTAGTGGTGTGAGACCAAGTAACAACAGTGCTCAGTCAG
GGACGCAAAGTGGAAGACCAAAGAAGGTCGTTCGGATCAATATAGAGTGAATGTACATAG
AGTGAATGTACGTGTTCACCGGATTGATATCGAGCCATGGAATGGAGAACCTCCTGGGTA
GAGGACTATACTATATTTGGTAGTTGCTTTAGGGTCTTGGTGAGAGGTAATAAAAGCAGT
CGTAGGTCTATAAAGAAGGGATCGATGTATCTGGGGTTGTTGTAATATTAATGCTTTATC
CAGAGATGTTCTTGTTCGACTTGACATAATACAATTGATTAAATAGTACTCTTTCAAGCA
ATATAGAAGAAAAAAACAAGTATATTTAGTCAAAG