Microarray Probes on PGSC0003DMT400066515

Probe IDChipProbe Sequence
CUST_14396_PI426222305 JHI_St_60k_v1 TAATCCTTGTATTGGTTGCTACCTTAGGTGAAAGTAGTTCAGAGATTGTTGCGCGACTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066515

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066515 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G33905.1 +2 1e-28 110 47/66 (71%) Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein | chr4:16254065-16255592 REVERSE LENGTH=261

Transcript Sequence (664 bp)

>PGSC0003DMT400066515 664 pgsc_dm_v3.4
TAGGCATTAACTTTGGATGCTTGTATCACTAATCCTTGTATTGGTTGCTACCTTAGGTGA
AAGTAGTTCAGAGATTGTTGCGCGACTCAAGCGCGACTTGGTTCCCACCATTGTCAGTGG
TCTTATGTACTGGCCAATATGTGATTTCATTACATTCAAGTTTGTTCCTGTTCATTTACA
GCCGCTTGTGAGCAATACATTTTCATACGTATGGAATGTATACCTGACTTATGTGGCAAG
CCAACAAAAAGTCTCAATGGTGTGATTCTATACCAAGCATGTATGATGTCTTCTCTGCTA
ACAATTCATATATTCTTCTTGCAAACAATCTGGATGGAGGCATGACTTTGGAGTCATTTT
CATCGCGGTAACATGTTAGTGTGGTGGAGCAGAAGCACAGAGACCGTTGAATGTGTTACT
TAAGAGTTGCTCGGACCATCATGGTTCTTTTTGTATATCCTAGTTCTAGTTACAGAAATC
GCGCATTACACTATCAGCTTTCACAAAAGAGCAATATCCGACAATATAGAGCAGGCATAG
TTCTAATTTTGAAGATTTTGCATTTGTATCCTCATTCTCAACTCATTAAACTCGGTTTAT
TCTTAACGTTAAAGTGAGTAAAGTTTTCATTCTCTCTTCTGTTTATTGTTTAAAAATTGT
CAAA