Microarray Probes on PGSC0003DMT400064551

Probe IDChipProbe Sequence
CUST_36553_PI426222305 JHI_St_60k_v1 TGTAATGTAAGAAGATGGTGTTTTGGATCTCTTCTCAAAATGTTTTCTAGCTCCATGATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064551

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064551 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G71695.1 +3 2e-79 247 116/177 (66%) Peroxidase superfamily protein | chr1:26964359-26966557 FORWARD LENGTH=358

Transcript Sequence (821 bp)

>PGSC0003DMT400064551 821 pgsc_dm_v3.4
GGTAATTTCAGACGGGTGGGCCCAACTACGATGTACCCTTAGGAAGAAAGGACGGAGTCA
ACTTTGCAACGGAGCAAGCGACGATAGACAACCTAGTTGCACCCTTTGCCAACACCACAA
CCGTCCTCTCTCTCCTTGCAACCAAAGGCCTCGATGCGACCGATGCGGTCGCGTTGTCCG
GGGCCCACACTATCGGTATCAGCCACTGTCCTTCCTTCACCGACCGTCTCTACCCAAACC
AAGATTCCACTATGGACAAGACATTTGCTAACAACCTCAAAGGTAGTTGTCCCACAGCTG
ACTCGAACAACACGGTCAACATGGACATTCGTAGCCCTAATGTGTTTGACAACAAGTACT
ACGTTGATCTCATGAATAGACAAGGGCTTTTTACGTCTGATCAAGATTTGTATACGGATC
GAAGAACTCGAGGGATTGTTACGAGCTTTGCGGTGAATCAATCGTTGTTTTATGAGAAAT
TTGTTATTGGTATGATTAAAATGGGACAAATGAATGTGTTGACTGGTGGAAATGGTGAAA
TTAGGAATAGGTGTGATAGGAGGAATAAGGATAAAAAGGTTGATATTGCTACTGTTGTTG
AAGAATTGGAGGAAACTTTCTCTGCTTTGTTCTAAGTTTAATTTAATTAGTCGTTTTTGT
TTTGGTTTTGTTGTAATAATAATGTGTCTTAACTAGCTTATAGTATAATAATCACATTTT
GTTTTGTGATGTAATGTAAGAAGATGGTGTTTTGGATCTCTTCTCAAAATGTTTTCTAGC
TCCATGATGATATCAAAATTGTGTTACTAGTATAACCTCTC