Microarray Probes on PGSC0003DMT400060396

Probe IDChipProbe Sequence
CUST_14242_PI426222305 JHI_St_60k_v1 GGCGGGTTGTGTTACATTTGTATGGATTAAAATCGGCGTTCAACTTAAAATCTCTTCTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060396

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060396 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G36380.1 +3 0.0 1969 1017/1454 (70%) pleiotropic drug resistance 6 | chr2:15257583-15263627 FORWARD LENGTH=1453

Transcript Sequence (5009 bp)

>PGSC0003DMT400060396 5009 pgsc_dm_v3.4
TAAATTGAGTTTTTTTTCTCAATATAATGAGACTATCCAACTTTTTTTTTTTTGTTTTCT
TCTTGTTTTAGAGACTATCCATGATCTTTTGTGTATATCAAGTTGTAATGTACGGTAAGA
CTGCGTACAATATACTATAGTGATTCCGGAGCAGAAGCTTAGTGCATCAGACTGTTGTCT
TTTGTGGGTATCAAGTTGCTGAACAAATCTTGAATTGGAAGCAGGGGATTACAAAGGTGA
TTCCAAAGGTGTAAATTTGAGTTTTACATAAAAGGGTGAAAATGTCAGCAACTATAAGCA
AAGATGAATTGAACAAGTCTCTAAGCCGACGATCGATGAGTAGGAGCAGGAGAATGAGTT
TTGGATCAACAAGTGTAAGAAGCTGGGCTTCAGCAAGTGTTACAGAAGTTTTAACTGCAC
CAGGAGGTGATGTTTTCCAGAGAAATGGGAGGGAAAACGACGATGAAGACGAGCTAAAAT
GGGCTGCAATAGAGAGACTTCCAACATATGATAGGCTGAGGAAAGGGATTTTAAAGCAAA
CATTGGATGATGGAAAGATTGTTCATCAAGAAGTCGATGTAACGAATCTTGGCTTGCAAG
ATAAAAAGCAGTTGATGGAAAGTATACTTAGGATTGTGGAAGAAGATAATGAGAGGTTTC
TTCTTAGGCTAAGAGATAGGACTGATAGGGTTGGGATTGATATTCCAAAAATTGAAGTTC
GTTACGAGCATCTTTCCATCGAAGGAGATACATATGATGGATCTAGAGCATTACCTACTC
TGTGGAATGCTACCATCAACTTTGTAGAGGGGGCTCTTGAAAAAATCAAGCTTGTCCCTT
CGAAGAAAAGGGCTGTCAAGATACTTCGTGATGTAAGTGGAATTATAAAACCATCAAGGA
TGATACTACTTCTTGGGCCTCCGGGAGGTGGGAAAACTACATTGCTAAAATCACTTGCTG
GAGTGCCAGACAAGGATCTGAGAGTCGCCGGAAAAATCAGTTATTGTGGTCATGAGCTCT
CATATTTTATTCCTCAAAGGACTTGTGCTTATATCAGTCAGCATGACCTTCATCATGGAG
AGATGACAGTCAGAGAGACGTTGGATTTTGCCGGACGTAGTTTAGGAGTTGGAACAAGAT
ATGATCTCCTCACAGAACTGTCAAGACGCGAAAAGGAATTGGGAATCAAACCAGATCCCG
AGATAGATGCATTTATGAAAGCTATAGCAGTTGCAGGCCAAGAATCAAGTCTAGTCACGG
ACTATGTTCTTAAGCTTCTTGGGCTGGATATATGTGCTGATATAATGGTAGGTGATCAGA
TGAGAAGAGGTATATCAGGTGGACAGAAGAAGCGGCTGACGACAGGAGAAATGTTGGTTG
GTCCTGCTAAAGTTTTCTTTATGGATGAAATCTCAACGGGCCTCGACAGTTCTACAACAT
TTCAAATTGTCAAATACATGAGACAGATGGTCCATATAATGGATGTAACTATGATAATAT
CCCTTCTTCAACCTGCACCTGAAACTTTTGAACTTTTCGATGACATTATTTTGCTCTCAG
AAGGACGCATAGTCTACCAAGGTCCACGTGAGAACGTGCTTGAGTTTTTCGAGAGTGTTG
GATTTAAATGTCCAGAAAGGAAAGGAATTGCTGACTTTCTCCAAGAGGTTACTTCTCTAA
AGGACCAAGAACAATATTGGTTCAGAGAAAACCAACCTTACAGATTCATTACAGTGGCTG
AATTCGCAGAACGTTTTAGCAATTTTCGTGTTGGACGTGAACTTCTCGATGAACTAGAAG
TTGCTTATGACAAAAGCAAAGCCCATCCTGCTGCACTTGTCACAGAAAAATATGGTATCT
CCAACATGGAACTCTTCAAGGCATGTTTATCAAGGGAATGGCTATTAATAAAGCGAAATT
CATTCTTATACATGTTCAAGACATTCCAGATTACTGTCATGTCAATAATAACCTTTACGG
TATTCTTTAGGACAGAAATGAAAGTTGGACAGATTGCAGACGGAGGCAAATTTTACGGGG
CATTGTTTTTCAGCCTAATCAATGTGATGTTTAACGGTGCAGCAGAGCTTGCAATGATCA
TTTTCAGACTTCCCGTGTTCTTTAAACAAAGAGATTCTCTATTTTATCCTGCCTGGGCTT
TTGCTCTCCCCATTTGGCTTTTAAGGATCCCCCTCTCCTTCATGGAATCATTGATATGGG
TTGTCCTTACTTATTATACCATTGGTTTTGCTCCTGCTGCAAGTAGGTTTTTCCGTCAAT
TCTTGGTATTTTTCGCTCTGCACCAGATGGCGTTGTCTCTCTTCCGCTTTATTGCTGCAA
TTGGAAGGACTCTAGTAGTTGCAAGCACTATTGGCACTTTCAGTCTACTGATAGTCTTTG
TGCTTGGTGGTTTCATTGTCGCAAAAGATGACCTCGAACCATGGATAAAATGGGGCTACT
ATGCATCTCCAATGTCATATGCACAGAATGCAATAGCGATCAATGAGTTTCTGGACACAA
GATGGAGTACTCATAACAATGACACTAGTTTCTCCGAGGAAACGGTGGGAAAGGTTCTTC
TTAAGTCAAGGAGCATGTATTCAGATGATTATATGTTCTGGATATGTATCATTGCCCTAT
TTGCCTTCTCATTTCTCTTCAACTTATGCTTCATCTTGGCGCTGACTTACTTAAACCCAT
TTGCTGATTCTACATCTGTTAGTATGGATGACGACAAAAGTAAGAAAAATGAGCAAAGAA
ACCGTAGCCCCAAAGAATCAACAGAGAAGAGTTCAGCATCTACCACCGCAACATTTGAAG
GTATAGATATGGCTGTGAGGAACAACTCGAGTATTGACAAAAGAGCATCCAAAAAAAGAG
GAATGGTGCTTCCTTTCCAGCCATTGTCACTTGCATTTAACCATGTCAATTACTATGTCG
ATATGCCAGAAGAAATGAAATCCCAAGGAATTGAAGAGACTCGTCTCCAATTGTTACGAG
ATGTTAGTGGCACTTTCAGACCTGGAGTCCTTACAGCCTTAGTTGGTGTAAGTGGAGCTG
GGAAGACTACTTTGATGGATGTCTTAGCAGGAAGAAAAACTGGTGGCTACACTGACGGAA
GTATCATCATTTCTGGTTATCTGAAAAACCAATCAACTTTTGCTCGGATAAGTGGTTATT
GTGAACAGAATGACATTCATTCTCCACATGTTACTGTTTATGAGTCATTGATATATTCAG
CGTGGTTGCGTCTCTCCCCAGATGTCAAAAAGGAAACTAGGAAGAATTTTGTCGAGGAAG
TAATGGAACTAGTCGAGTTGAATCCTCTCCAGAATTGTCTAGTTGGCCTGCCAGGGGTAG
ATGGTCTCTCAACTGAACAAAGAAAAAGACTGACCATAGCTGTTGAACTGGTAGCAAATC
CATCTATTATTTTTATGGATGAACCTACATCAGGACTTGATGCTAGAGCAGCGGCAATTG
TTATGCGAACTGTGAGAAATACAGTAGATACAGGCCGAACTGTCGTGTGCACTATCCACC
AGCCAAGCATAGATATATTTGAAGCTTTTGATGAGCTGTTGTTAATGAAAAGAGGAGGAC
AAGTCATTTATGCAGGGCCTCTCGGACATCATTCTCGCCTATTGATTGAGTATTTTCAAT
CTGTTCCAGGAGTTCCAACAGTAAAAGAGGGATATAATCCGGCTACTTGGATGTTGGATA
TCACCACTCCAGCAGTTGAGGGTCAACTAAATGTGGACTTTGGAGACATTTATGCGAACT
CGGATCTATATAGGCGGAATCAAGAACTAATCAAACAACTAAGTGTTCCAGTACCAGGGT
CCCAAGACCTTCATTTCCCTACGAAATATTCACAACCGTTTGTTGATCAGTGCAAGGCTT
GCTTTTGGAAACAACACTTATCCTATTGGAGACATCCGCAATATAATGCCGTAAGGTTTT
TCATGACAGCAATTATAGGGATCATATTTGGAATTATCTTCTGGGATAAAGGGAACAAAA
TGTACAAACTGCAAGACCTATTGAATCTACTGGGAGCTATGTATGCTGCTGTTATGTTCC
TTGGCGGAACAAACACTTCAACTGTGCAGTCAGTTGTGGCGGTAGAAAGAACAGTCTTTT
ATCGAGAAAGAGGAGCAGGGATGTATTCTGCGCTGCCTTATGCATTCGCTCAGGTGGCCA
TAGAGACTATCTACATCGCGATCCAGACTGTTATTTACAGCCTCCTTCTGTACTCAATGA
TCGGTTTTCACTGGACTGCTGCTAAATTCTTTTGGTTCTATTTCTTCATTTTCATGTGCT
TCGTTTACTTCACAATGTACGGAATGATGCTTGTAGCACTCACTCCAAACTACCAGATTG
CTGCCATCGTCATGACATTCTTCCTCAGCTTTTGGAACTTGTTCTCTGGTTTCCTTATCC
CTAGACTGCAAATTCCAATATGGTGGAGATGGTATTACTGGGGTTCTCCAGTAGCATGGA
CGATATACGGTCTTGTAACATCTCTTGTAGGTGACAAGAACGATAACGTTGAGGTACCAG
GCGTTGGCGAAATACCATTAAAGCTATTTTTAAAAGATTATTTGGGATTTGAGTATGACT
TCTTGGGAGTTGTTGCTGTTGCTCATGTTGCTTGGGCTGTTCTGTTCTCCTTTGTTTTTG
CTTATGGCATAAAGTTCTTGAATTTCCAAAGGAGATAAATTAACTTGAAGACAATACATA
GTTTTGTGTACACATAAATGTTATCAAACTTGTGTTGGATCCTTCAAGAATGCACTACTT
TTGGAGGATCTAACACGTACCTGGTAACATTTTTGAAGAATTCAAGCAATATAGATCATA
TATTTATTTAATTTTGATGTATAAATTTCTCTTCAACTCTTGTGATGTTAAATAAGTAGA
ATGCACACATACGAGGTATCAAATGGTCGGGCGGGTTGTGTTACATTTGTATGGATTAAA
ATCGGCGTTCAACTTAAAATCTCTTCTTT