Microarray Probes on PGSC0003DMT400056342

Probe IDChipProbe Sequence
CUST_48904_PI426222305 JHI_St_60k_v1 ATCCTTACCCACCTTTGAACTAATATGAAGAGACAGATCGATGACTTATGTTGTTCGGAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400056342

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400056342 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G13700.1 +3 7e-92 281 146/210 (70%) 6-phosphogluconolactonase 1 | chr1:4694475-4695600 REVERSE LENGTH=268

Transcript Sequence (1259 bp)

>PGSC0003DMT400056342 1259 pgsc_dm_v3.4
AGTAAACTACTCGCTTTAAGATATACATATTACAAGATTCAGAAATTGCTAATACCCATT
TTTCCCTTTTCTCCTCTTGCAGTGAATGATGGCTTTTTCAGGAGCTAAAGAAGATGGAAG
AGAGGTGAAGATTTACGAGTATTTGGATGAACTAAGTACTGATCTAGCAGAGTATATATC
AGAACTATCAGAAGCTTCTGTGAAAGAGAGGGGAGTATTTGCCATCGCATTATCCGGTGG
ATCGCTCATTAGTTTAATTAGGTATGTAAGCACACTCTCTATCTGTTCATATTTGTTCTG
TTGCCTTCTCTATAAGATTGTGTAAATATGTTTGAAAACTTGGAGGAAGCAGAAAACTAT
GTGAAGCCCCTTACAGCAAGACTGTTGATTGGTCCAAATGGTATATATTTTGGGTGGACG
AACGTGTTGTGGCGAAGAATCATGCTGATAGTAATTACAAGCTAGCCAAAGATGGATTTT
TGTCTAAGGTACCTATAGTTCCAAGCCATGTACATTCGATTAACGACACAGTGTCAGCTG
AGAAGGCTGCTGAAGACTATGAGTTTGTAATTAGACAGCTTGTAAGGACTCGTGTAATCA
GCGTTTCAGACGTTAGTGACTGCCCCAAGTTTGACCTCATCCTACTCGGGATGGGCCCTG
ACGGTCACATTGCATCTCTATTCCCTGATCACTCCATACTCGATGAGAAAGACGAATGGG
TGACTTTTGTAACTGACTCACCTAAGCCTCCTCCGGAGAGGATAACATTTACTTTGCCTG
TGATTAACTCTGCTTCTAATGTGGCTGTGGTTGTAACTGGAAGCAGCAAAGCAGAGGCTG
CACATTTGGCAATTGATGATGTCGGGCCTGACGTTCCGTCATCGCCTGCAAAGATGGTCC
AGCCAACTAAAGGGAAATTAATATGGTATCTGGATAAAGCAGCTGCCTCAAAACTAGATT
GCACAAAATTTTCAGAGTAGGGCCAGGGTTTCAAGTTCCCTTGTCAACAGAATGTACAAC
TGTATGGGGCACAAAGCATGTGGAACTTAGTACATTCTAATCTTTTGTCAGGATTTTATA
GTTCATCTTTTCTTAATTTCACAACTTTTTTATGTCCTTTTGGAATTAGAGTGGTTATTG
GACTTTTGTGATGGATCAAGTATCTTCCCTATTCTGATGTAAGGGAACATCAATAATAGA
TCCTTACCCACCTTTGAACTAATATGAAGAGACAGATCGATGACTTATGTTGTTCGGAC