Microarray Probes on PGSC0003DMT400056192

Probe IDChipProbe Sequence
CUST_49345_PI426222305 JHI_St_60k_v1 CAAATTGTATGTTGGTTGCTTTAGCTCAGAAAGCCAGCAACATCTTGTTTCTATTGAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400056192

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400056192 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G22240.1 +2 0.0 935 454/510 (89%) myo-inositol-1-phosphate synthase 2 | chr2:9451901-9453938 REVERSE LENGTH=510

Transcript Sequence (1962 bp)

>PGSC0003DMT400056192 1962 pgsc_dm_v3.4
TGAACACTTGTTCTTCTTCTAAATTGAACAATTTCTCTGATTTCTCTGCTTTTTTTTTGT
CAAAATGTTTATTGAAAATTTTAAGGTGGAAAGCCCAAATGTGAAGTATATAGAGAATGA
AATTCACTCTGTGTATGATTATGAAACCACAGAGCTTGTTCATGAAGAGAGAAATGGAAC
TTATCAATGGATTGTTAAGCCTAAATCTGTCAAATATGAATTCAAAACTGATACTCATGT
GCCAAAATTAGGGGTTATGCTTGTTGGATGGGGAGGAAACAATGGTTCAACATTGACTGG
AGGTGTTATTGCGAATCGAGAAGGAATTTCATGGGCAACGAAAGAAAAAGTGCAGCAAGC
AAATTATTTTGGGTCTCTTACTCAGGCATCAACAATTCGAATTGGGTCTTACAATGGCGA
GGAGATCTATGCACCCTTCAAGAGCCTCCTTCCCATGGTCAACCCAGACGACGTAGTATT
TGGAGGATGGGACATTAGCAACATGAATTTGGCAGATGCCATGGTCAGGGCTAAGGTTTT
CGAAGTTGATCTGCAAAAGCAGCTGAGGCCCTACATGGAATCCATGGTTCCTCTTCCTGG
TATCTATGACCCTGACTTCATTGCTGCTAACCAAGAAGCACGTGCCAACAACGTGATCAA
AGGAACCAAGAAAGAACAAGTTGATCAAATTGTTAAAGATATTAGGGAGTTCAAGGAGAA
GAACAAGGTAGACAAGATAGTGGTTCTATGGACTGCCAACACCGAAAGGTACAGCAATGT
GGTTGTTGGCCTTAACGATACCATGGAAAACCTTTTAGCTGCTGTGGATAGAAATGAGGC
TGAAATATCTCCTTCTACATTGCATGCTATTGCTTGTATTCTGGAAAATGTGCCTTTCAT
CAACGGAAGCCCTCAAAACACTTTTGTTCCAGGTCTTATTGATTTGGCCATAAAGAGAAA
CACTTTAATTGGTGGTGATGACTTTAAGAGTGGTCAAACCAAGATGAAGTCCGTGTTGGT
TGATTTCCTTGTTGGAGCTGGTATTAAGCCAACGTCAATAGTGAGCTACAATCACTTGGG
TAACAATGACGGAATGAATCTTTCTGCTCCTCAAACCTTCCGGTCTAAGGAGATCTCAAA
AAGTAATGTTGTTGATGACATGGTTGCTAGCAACTCCATTCTCTATGAATCTGGCGAGCA
CCCTGACCATGTTGTTGTGATCAAGTATGTTCCATATGTTGGAGACAGCAAGAGGGCAAT
GGATGAGTACATGTCAGAGATTTTCATGGGCGGAAAGAGCACCATAGTTATGCACAACAC
TTGTGAGGACTCTCTTTTGGCAGCTCCAATTATCTTGGACTTGGTCCTTCTCGCTGAACT
CAGCACTCGCATTCAGCTCAAAGCTGAAGGGGAGGGGAAGTTCCACTCCTTCCACCCTGT
GGCTACTATTCTCAGCTACCTCACCAAGGCTCCCCTGGTACCACCAGGTACTCCAGTGGT
GAATGCCCTTTCAAAACAGAGGGCAATGCTTGAGAACATAATGAGAGCTTGTGTTGGTTT
GGCACCAGAGAACAACATGATTTTGGAATACAAATGAAAATATATGCAGATGAAGGAAAT
TACTAGAAGAGAATGGACTCAACTCAAGTGTAGTTGCATTTGTAGAAAAGATCCATTCTC
TATTTATTTATTTTTCCCTTTTTGTATCTTATATTTTCTGTTTTCTATTTTATCATCATC
ATATAATTAAGTAAAGTGTGGCATGATTGTGAAGTGTAGGAGAGCTTAAAAGGGCCAAAG
TCTTGTTTATTGTAACTTCTTCTCTTTCATGTTTTTGGCCCTCTTGTCTCCAAATTGTAT
GTTGGTTGCTTTAGCTCAGAAAGCCAGCAACATCTTGTTTCTATTGAAAAAAAAATACAA
CATGGTGATTTAAATTTTGATTTAGTAATTCACATTTTCCCC