Microarray Probes on PGSC0003DMT400054318

Probe IDChipProbe Sequence
CUST_52514_PI426222305 JHI_St_60k_v1 GATACTAACCCTCCATCTCTCATTACCGATGTACTCATTTTCGATATGAATAATACATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054318

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054318 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G46240.1 +1 2e-65 220 110/186 (59%) potassium channel in Arabidopsis thaliana 1 | chr5:18743652-18746561 REVERSE LENGTH=677

Transcript Sequence (948 bp)

>PGSC0003DMT400054318 948 pgsc_dm_v3.4
ATGATTTTTGTTGTGTCAGAGGATAATGTAGAAGTAGCTCAAGAATTCGCAAAACAGAAT
CAGTTGTCACCAAGGATACAAGATCAGATTTTGTCTCATATATGTCTTAAGTTCAAAACT
GAATCATTGCAACAAAAAGAGACCATGAATGTTCTGCCAAAAGCTATCAGATCAAGCGTT
GCACTTTACCTGTTTTTACCAATAGTTCAAAATGTCAGTCTGTTCCGAGGTGTTTCCAGG
GACCTGCTTTTCCAACTGGTTCCTGAAATGGAAGCTGAATACTACCCTCCCAAGGAAGAT
GTGATTTTACAGAATGAGTCTCAAACATATTTTTACATAATAGTCTCAGGAGCATTGTAT
CTTCTAGTAGATATCGATGGATGTGAACAAATCATTGGGAAGGCTGTTGTTAGAGAATCA
TTTGGAGAAATAGGTGTTTTACTTGGAAGGCCACAACAATATGCTGTTAGAACAACTAAA
ATTTCTCAAATTTTATGTCTGAGTAGGAAACCATTTCTGAACATTCTTCGCGACAATCAA
GAAGATGAACGGATTAAAATGAGAAATCTTGTTCAGAAAACTTTATTTCTTGGTCGTGTG
GCTAGCCCGTTGTTGGCCGAGATCATAGGGGTGTATGAGGCTCTTAGTTGGCTAAAGGAA
CGGTTCAGTAGAACGAGGTTGGTTGTGGAAACTGATAATCTACTTGTGAAGCAAGCTCTG
GAAGAAAACTTGGTGAATTACTCTTACTTTGATTCTTTAGTTTTTGATTGTAAAACTCTT
ATCCAAGAGTTACCATTTCTCTCTTTGTCTGCTGTTAAGAAATTAACGAATCAGGTTGCT
CATTGTCTTGCTAGTGCATCTGTTTCTATGTCTGGTTCATTGGAGTGGGATACTAACCCT
CCATCTCTCATTACCGATGTACTCATTTTCGATATGAATAATACATGA