Probe CUST_52514_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_52514_PI426222305 | JHI_St_60k_v1 | DMT400054318 | GATACTAACCCTCCATCTCTCATTACCGATGTACTCATTTTCGATATGAATAATACATGA |
All Microarray Probes Designed to Gene DMG400021079
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_52514_PI426222305 | JHI_St_60k_v1 | DMT400054318 | GATACTAACCCTCCATCTCTCATTACCGATGTACTCATTTTCGATATGAATAATACATGA |
Microarray Signals from CUST_52514_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 124.902 | 19.4512 | 1.15167 | 0.17003 |
| ABA 1h | 96.2311 | 6.24266 | 1.02721 | 0.0665747 |
| ACC 1h | 84.9457 | 22.5848 | 0.710931 | 0.187629 |
| BABA 1h | 129.575 | 30.293 | 1.19376 | 0.195068 |
| Chitin 1h | 67.8496 | 10.1066 | 0.696136 | 0.165145 |
| Epi 1h | 114.701 | 18.4594 | 1.21627 | 0.202923 |
| SA 1h | 110.31 | 10.152 | 1.00632 | 0.11811 |
| Me-JA 1h | 19.9953 | 3.40687 | 0.224042 | 0.0385744 |
| Control 6h | 119.5 | 25.5699 | 1.07621 | 0.144332 |
| ABA 6h | 145.899 | 22.3871 | 1.26448 | 0.145726 |
| ACC 6h | 133.913 | 13.8649 | 1.09252 | 0.0737598 |
| BABA 6h | 152.475 | 22.9132 | 1.26144 | 0.146248 |
| Chitin 6h | 99.6754 | 17.6788 | 0.857628 | 0.128971 |
| Epi 6h | 134.285 | 33.8027 | 1.06284 | 0.250869 |
| SA 6h | 110.054 | 46.7531 | 0.883387 | 0.584013 |
| Me-JA 6h | 104.331 | 28.588 | 0.893991 | 0.251058 |
Source Transcript PGSC0003DMT400054318 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G46240.1 | +1 | 2e-65 | 220 | 110/186 (59%) | potassium channel in Arabidopsis thaliana 1 | chr5:18743652-18746561 REVERSE LENGTH=677 |