Microarray Probes on PGSC0003DMT400052686

Probe IDChipProbe Sequence
CUST_26951_PI426222305 JHI_St_60k_v1 CAAGTACTCCAAAAGATTTGGATATGAGCGAGAAAAGTGGATTAAGTGCAGCGAAAGAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052686

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052686 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26330.1 +1 3e-45 157 85/173 (49%) cytochrome P450, family 71, subfamily B, polypeptide 37 | chr3:9646873-9648536 REVERSE LENGTH=500

Transcript Sequence (543 bp)

>PGSC0003DMT400052686 543 pgsc_dm_v3.4
ATGGCAAAAGCACAAAGCGAAGTGATACAAGCCTTCAAAGAGAAAATTGATTTTGATGAA
GAAGATCTTGATAACTTGCCATATCTAAAGTTAGTGATCAAAGAAACATTAAGGCTACAT
GCTCCAAGTATAGTCAATAGGGAATGTAGGGAAGCAACAATCATTGATGGATGTACAATA
CCTGCTAAGGCCACAATACTAGTCAATACATGGGCAATAGGAAGAGATCCTGAAGTTTGG
GATGATCCTGAAAGTTTTATACCAGAGAGATTTGAAAATTCTACTATTGACTACTTGGGA
AATAACTATGAGTATCTCCCGTTTGGTGCAGGAAAATGGATTTGGCCAGGAATGCAGTTT
GGTTTAGCTAATGTTAAACAACCTCTAGCTCGGCTCCTCTACCACTTTGACTGTGGACTT
CCATGTGGAACAAGTACTCCAAAAGATTTGGATATGAGCGAGAAAAGTGGATTAAGTGCA
GCGAAAGAGAAAGATCTCTACTTAATCGCCAAAACGAATCAAAGTTTGGATATCATGCTC
TAA