Microarray Probes on PGSC0003DMT400052621

Probe IDChipProbe Sequence
CUST_19042_PI426222305 JHI_St_60k_v1 GCAGAAGAACATGGAAATACTCAAATTTCAACTGTCATTTTTGATTTGGATGGTACCCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052621

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052621 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21470.1 +3 7e-81 261 159/362 (44%) riboflavin kinase/FMN hydrolase | chr4:11431284-11433197 FORWARD LENGTH=379

Transcript Sequence (1709 bp)

>PGSC0003DMT400052621 1709 pgsc_dm_v3.4
GAACAATAATATTTGGTGTTATAGTACTTGGAATACCGAATAATTACTTTTGGAAGGCGG
GAAAAAGACTCCCTCCCCATATTGTGTAAGCACCTTTGCCCAATTGCAAATTGGAATTTG
ATCCTTTCGTTAAAATATTTCTTTAAAATCCTTCATATTATTATATGCTTTTTCTGCTCA
TTCATCAGATTTCACAGCAAAGCCTAAAACTTCTCTGACACTCAACAATGGGGGATCTTC
ATTCTGCAGAAGAACATGGAAATACTCAAATTTCAACTGTCATTTTTGATTTGGATGGTA
CCCTTTTGAGTACAGAGCACTTGACAAAGGAAATTCTGAAGGAATTTCTGGCTGGATATG
GGAAGGTGCCAGATAAGGAGAAGGAAAAGAAAAGATTGGGCATGGCCCAGAAAGAGTACG
CTATTGGCATTGTCAGTGATTACGACCTCCCTATCACGCCCGATCAGTATGTCCAAGCAG
TCATGCCCTTTTATCATGACTTGTGGTTGCAAGCGAAAGCACTTCCTGGTGCTAATCGCC
TTATAAGACATCTCCATAAGCATGGAGTTCCCTTTGCCCTTGCTTCAAATTCCAAAAGGA
AAAACATAGATGGGAAAGTCTCTCTCCAAGAAGGTTGGAAAGAATGTTTTTCCGTAATTC
TTGGAAGTGATCAGGTTAAATCAGGGAAGCCTTCTCCAGACATATTTCTTGAAGCTGCAA
AACAAATGGGTGCAGATGCAGCTCACTGCCTAGTGATAGAGGATTCTGTTATCGGAGTCA
GGGCAGGCAAGGCTGCTGGAATGAAGGTGGTAGCTGTGCCATCTTTCCATTCTGAATTTG
ATCAATATACAATAGCTGATTCTGTGCTTCGTTCACTCCTAGATTTAAAGCCGGAAGTAT
GGGGTCTCCCACCATTTGAAGACTGGGTTGATAATGCGTTGCTGGTTGAACCTGTTCATT
TCAGGGGTCTGTACAAAAATGGCCTCCTCCATGATTTTGCAGATGATGGGCCGTCTACTC
TACCCGATCAAGTGTTTGGAGTTTATTTTGGCTGGGCAAAACCTGAGGCTTACAAGTTCA
TAAAGATTGTTCTTGGCAATGGTTGGGGACATGGCTGCTGCAGTTCTAAGAGGAAGATGC
AAGCTTGTATAGTTGATTCAAGTGACGAACAGATCCAGCCTGGCAAAATGGAAGTTGTGA
TTGTAGGTTACATCAGAGGATCACACGATGAGGGAAAATCGGGCAAAATAGAAATACTTG
AGGAAGACAAGTCCATTGCCAATGCTGCCTTGAATCTGTCTGAATTCTCCCTAGGTACAT
TCAAGTCTCTCTTCTCTGAAGTTGCTGTACAAGATGAGTGCGACCTTAACGTAAAATGAA
CAAGGATATGATTGGCATTAGCATAGCGAGTAGTTACGTCCGTTACCCTGAAAGAGGAAA
TATGTCTTCTTGGGATCAGGGCGACAAAAAAAAACATGAAATAATTTTTGAAACTCAGAA
CTTCAATCATTGTTCTGGTTTCTTGCTCACATGGTTATGGATTAGTAGCCTGCCCACCAA
TTATTCTGTAAAATTAACAATCCCATGGTTGAATTTCATAATTACTATTAGTGCTTTGCC
AATGGATTGAAAATAATGAAAATTTGTGTTTAGTTTAGTCTTTTGCAGTTTCTCCTTTTA
CTCTATGTTCACATGCCAGGTGAATTCAG