Microarray Probes on PGSC0003DMT400051532

Probe IDChipProbe Sequence
CUST_42865_PI426222305 JHI_St_60k_v1 GTTAAGACTGCCAGGCAGAAAGCTTCCCTATTTGCACTTCACATATTTATCTACTCACAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051532

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051532 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G40070.1 -2 6e-18 84 37/50 (74%) BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr2:16728378-16731160 REVERSE LENGTH=607

Transcript Sequence (891 bp)

>PGSC0003DMT400051532 891 pgsc_dm_v3.4
ATGATGTTCAAAAAGGAAAATGTTGACATTCTGAGAACTCAAACTGGCTCAACAGATGAA
GACCTGACATTAGCTGCTCCAGGTCTGACCCTTGTAGCTGAAATTGGCCTGTCAGGTAGT
GATGTCCTTAAATTGGGTGGAGCATCAAGGGAGAACCCTGGTATATCTGAAGGCTTCCAT
GGTCTGGGTTTTACAGTTGGAGAACTAGCACGTGAGGCTGCAGGGTTTCGTGATGCCGTT
GTAGCTGACCTGGTACCCGAAGGGGAATACATAGATTTAACTGGAGGAACAGTTGTATTT
GTTGTACTTGACACTGAAGTTGCTCGACGAGTTGGAGTTGCTGCCCTTGATGTGGACTTT
GATCCAGTAACTGAGGCCCTGGTTGTTGGTGTTGAGGACCGTGCACTGGATCTTGCAGTA
GGTGTTGAAGATCTTGGAGGAACAGTGGGTTTTGCAGAAGGCATGGTGTCCCGAGAAGTA
GGTGTTGCAGACCTTGATGATCTAGATGCTGTCGTGGTTGACATTGATCTAGAGGTTGCA
GTGGATGCCATTGCTTTGGTTGCTGCAGCAGATGTGGATCTAGATGCTGAGGTCGAGGTG
GATCTAGATGAGCTCAATGTCGGTCTACCAGTAGGAGTTGAAGGTCTTGATCCACCTGAA
GAAGATGGTCTTCGAAGAATAGAACTTGAAGTGTTTAATCCGAGAGAGGAAGCTAGCTGT
CTAGATGCTAAGTTGCTTCTTGAGGTGGCCTCTAGGAGAGAATTTGTTAACTGCATCAAA
GTTGGCAAATTACAGATAAAAATATATCAAAACTGTGATACACTTCAGGTTAAGACTGCC
AGGCAGAAAGCTTCCCTATTTGCACTTCACATATTTATCTACTCACAGTAA