Microarray Probes on PGSC0003DMT400050753

Probe IDChipProbe Sequence
CUST_18590_PI426222305 JHI_St_60k_v1 CTGATTTTCATCGAGCTATCACCTATGGCTTCGAGCTTTATTATATCGGGTTTATAGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050753

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400050753 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G66910.1 +3 2e-50 143 69/123 (56%) Protein kinase superfamily protein | chr1:24961634-24963941 REVERSE LENGTH=666

Transcript Sequence (2720 bp)

>PGSC0003DMT400050753 2720 pgsc_dm_v3.4
TCAACACTAAAAGAGGTGAGCAGAATGGTCGTCCCCCTATCCTTCACTTTGAACTGGAAT
TTGTGGACTACTTCAGTCTCTCTTGTTTGCTAGTTGGAAATTATTGGGAGAAGAAAATTG
ACTCCAGCAACTATACAATGACTCCCTCTTCTTTCTGTTCATCCAATAGAGCTGATCTCC
TTTTTAAAAACAATGTGTAGGGGAACAAACATTCTGCTAAAATGTTATACAATCCTCATC
TTTCTTCACATTTCACAAACATGCAATGCTTGGAACTTGAAGAGCAAACACTGTATCCCT
TCTTCTTGTGGTCATATCCGTGACATAAGCTACCCTTTTCGCTTAAACACCGATCCAAAA
CATTGTGGTTTCTCAGAAGCTGAATTAGCTTGTTAAGGCAACAAAACCATTATATCACTC
TTCTCCAAGAACTTGTATGTGCAAGCCATCAACTACGATAACCAGACAATTCGCCTGGTA
GATCCAACGTTACAAAATGCTGATATATGCTCTCTAATATTACCTCCTCATCTTAATTCC
CACCATTACAATAGTACACATTTTCGTCTGTATTATAATGGATCAGAGAATAGTATTAAA
AGAGCAGCAGAGCCTATCTTCATGTTCAACTGTCCCTTTGCTATTAATACATTTCTAGAA
ATTAGTGGCTGCAAATTAAACAGATACACTTACTTAAAGATTGGAGAAATGAATGCATCA
GAAGTCAGTGATGGATGCAGAGTACAACTCATCGGCCTGACCTCATGGCCTAATATTAAA
GAGGCAGAGAACAACATTTCCCTTTCTGATTTTCATCGAGCTATCACCTATGGCTTCGAG
CTTTATTATATCGGGTTTATAGAAAGGGATATTTGGATGTCACTTGGGCTGTTAATTGGG
AGTTTCTTGGGTAAGCTCGTATCCCTTTAGCAAGTTGTATTATTTGGCCGGACAGAATTA
GCATTTCGTTAGTATTAGTCTGTTGGTTTGTCATAACAATTATCATCTCTTCATTTCCAC
AACTCTTTTACACCTTGAAGGTGACATACAACAGCAGGTAACTATCTATAATAAACCTAA
TTTTATGGTTTACTTGGAACCAGACAAAATTATGCCTTAAGAGAATGTAGGAACATTCTA
AGTTACTTTCTTATTCCTGATAATCTTTTTATTTCCTTAGTACAACTTCTCAAACATGTA
GGGTCTTTAATACTGAAATTTATGATCGGCCTTCCGTTCATAATTTTATTTCTGGGGTAC
AAATTCAAGAGGCGGCATTTGTCCATGTATGATGCGATTGAAGGCTTTTTGCAAACACAA
AACAATTTCATGCCAATCAGATATAACTACTCCCACATAAACAGAATGACCAGAGGATTC
AAAGAGAAATTAGGTGAGGGAGGTTACGGTAGTGTATACAAAGGAAAACTTCGAAGTGGA
AGACATGTAGCAGTGAAGATGTTGAGCAAGCCTAAAGCTGGTGGGCAAGATTTCATGAAT
GAAGTAGCTACCATTGGAAGGATTCATCATGTACAATGTGGTTGGACTCGTGGGGTATTG
TGTTGAGGGAACAAAAGCGTGCTCTTGTATACGACTTCATGCCCAACGGATCACTTGATA
AGTACATCAGCACCAGTCAAGAAGAGAGTCCTCGGTTAAGTTGGCAGAGGAAGTATGACA
TTATTCTTGGAGTGGCTCAAGGAATTGGGTATTTGCATCAAGGCTGTGATGTACGGATTT
TGCATTTTGATATCAAGCCACACAACATTCTTTTGGATGAGAATTTCATTCCAAAGATTT
CTGACTTTGGGCTTGCAAAGTTATATCCAACAGATAATAGCATTGTGACTCTCACAGCTG
CTCGCGGAACGATTGGATATGTAGCACCAGAGTTGATCAGCAGAAGCATTGGAGCAATCT
CTTAGCATTGTGACTCTCACAGCTGCTCGCGGAACGATTGGATATGTAGCACCAGAGTTG
ATCAGCAGAAGCATTGGAGCAATCTCTTACAAAGCTGATGTTTACAGCTTTGGAATGCTG
CTAATGGAAATGCTGGACTTGAATAGACATGAAGTTGCAAATGAAGAGAATTCCAGCCAA
TATTTCCCATATTATATTTACGATAAGTTCAACAAGGGGAAGGAGATTGTGGTGGATGAA
GAAGCGAATGATGATGAAAAGAAGATGGCTAGAAAGCTGAGTTTAGTTGCACTATGGTGC
ATACAAACAAATCCGATACAACGCCCTTCGATGAGTAAAGTAGTAGAAATGCTTGAAGGT
GAAGTTGAAGTGCTAGAAGTACCTCCTCAGCCTATTCAATCTCAACCGATTGTTCATCAG
ATGATGGAAAGTTCTATGACATTTTCTTCTGATTCAATGGCTTTGTTAGAAAATTCTGCT
GATAATCCCATCGAAGTAGTCTAGGGTTGATTTTTTTACTTGATTTTTGAGCAGAACTTT
TTTGTGCCAATATGGGTCTCTATGGACTCGTGTATTTACCTAGATTAGGTATTTGACCAA
ATGAGGACCGTTTAGAGGAATTAAGGAAAGGCAATGCCATAATTTGATTTTTTTTTCCCG
ACCCCAATTAAGCCAAGTTGAGACGCAACGTGAGCTTATTTTATAATGTGTTACGCTCGT
CACATGGGTCCACATATAACAACATCCCATCGGGGCCATAATTAATCACAACACTTTGCC
TGAAACACATCTTATCATGC