Microarray Probes on PGSC0003DMT400050287

Probe IDChipProbe Sequence
CUST_45815_PI426222305 JHI_St_60k_v1 GCACCAGCACAAGAAGAAGAGTTTATGGGAATGGGTTTGGGTGAATCTGCTGACTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050287

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400050287 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62470.2 +1 4e-98 303 188/384 (49%) myb domain protein 96 | chr5:25079434-25080858 REVERSE LENGTH=352

Transcript Sequence (1500 bp)

>PGSC0003DMT400050287 1500 pgsc_dm_v3.4
CACAACTTTGCTATACTCTTGAACAAAATTTCCTACAAAGAGAGCAAAGCAATACATAAA
AACTAAAGATACATCCATTGATCTTCAAGTCATATAAAGAAAAAGATCCTTTTGTTCCTA
GATATCGATCGTGTAGCTAGAATGGGAAGACCACCTTGCTGTGATAAAATTGGGGTGAAA
AAAGGACCATGGACACCAGAAGAAGATATCATCTTGGTTTCATACATTCAACAACATGGT
CCTGGTAACTGGAGAGCTGTTCCCAGTAATACTGGTTTGCTTAGATGCAGCAAAAGCTGT
AGGCTCAGATGGACTAATTATCTCCGGCCCGGAATTAAACGTGGAAACTTCACTGAACAT
GAAGAAAAAATGATTATCCATCTCCAAGCTCTTCTAGGCAACAGATGGGCTGCGATTGCT
TCGTATCTCCCACAAAGGACGGATAACGATATAAAAAACTACTGGAATACTCATCTGAGG
AAAAAGCTGAAGAAACTTCAAGGGAATGATGAGAATAGTACTCAAGAAGGAACAACCTCA
TCATCATCTCAATCAAATTTCTCAAAGGGACAGTGGGAGAGGAGGCTTCAAACAGATATT
CACATGGCTAGAAAAGCCCTTTGCGAGGCTTTATCACTTGACAAATCTGATTCATCTGCT
AATCCAATTAGCCCAATTCCTGCTCAACAACCCGTTACAGGATCCAGCTCTTATGCATCC
AGTGCGGAAAACATTTCCAGGTTACTTCAAAATTGGATGAAGGATTCCCCCAAATCATCT
GAATTAAGTCGATCAACTTCTGAGACAACTCAAAGCTCGTTGAATAACCCGTCAATTGGG
TCGGGGTCAGGGTCAGGGTCGAGTCCTAGTGAAGGTACCATAAGTGCTGCAACACCTGAG
GGATTTGACTCCTTTTTTAGCGAAGGTAATGCTTTCACACCTGAGATTTTTCAGGTGGAA
AGCAAGCCAAATTTTCCGAATGTGAATTCGGAAAATGGTTTTTTGTTTCAAGCGGAGAGC
AAGCCAAGTTTGGAAGAGTCACAAGTCCCGTTAACTTTGCTAGAGAAGTGGCTATTTGAT
GATGCTATTAATGCACCAGCACAAGAAGAAGAGTTTATGGGAATGGGTTTGGGTGAATCT
GCTGACTTTTTTTGAAGAAATATTTACTAGTAAATGACAGCTCTAGTAAATATTTCTTCA
GAAAAAACATAGAAGTTCAAATTTGGGGTTTTCTTTAATGTCTTTTTAATGTTTGTTACT
TGTTAATTAGAGCTTTGTAATTTAGTTTAACAGGTTTACTTACTTAGTAGCTAGCCTGAG
CAAAAATTCTAAAATTTGCAAGAGTAAAGAAAAGTGTATATATTACAAGTAATCTTAAAT
ATATGCACATGTAGTGAATAGTTTATAGTAGTACTAGTAATAATATTTACCAGACTCTTT
AGATTCTATAAGAGCTTCAACTGTTTGTACTATGTGCTCAAATATTTTATTGAGTAAATG