All Microarray Probes on Gene DMG400019535

Probe IDChip nameTranscript IDProbe Sequence
CUST_45815_PI426222305 JHI_St_60k_v1 DMT400050287 GCACCAGCACAAGAAGAAGAGTTTATGGGAATGGGTTTGGGTGAATCTGCTGACTTTTTT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400019535

Click here to view details at Spud DB Genome Browser (opens in new window)