Microarray Probes on PGSC0003DMT400047955

Probe IDChipProbe Sequence
CUST_45926_PI426222305 JHI_St_60k_v1 TACTAGGACTATTCATCTTTTAGAATTTCATTTTCACCGTGAAGTTGGGATCCGTGTCAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047955

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047955 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G60620.1 +3 1e-68 238 110/134 (82%) glycerol-3-phosphate acyltransferase 9 | chr5:24367266-24369647 FORWARD LENGTH=376

Transcript Sequence (3890 bp)

>PGSC0003DMT400047955 3890 pgsc_dm_v3.4
GTGGGAGACGTGTCGTCAAGGGTTTGGATTGCGTGAGAAAAACTAGTGAGCGAAATCCTC
CTGGATATATATAAAGATTCAACAATTGTTTGTATTTTGATAGATAAATTACTACTGCAT
GTTAAATGTTGAAGCTCCGAATTGGAGTTGGATGGACCCGACTATCTACGCTCTGAATCC
ATTCAAGAACCACCATGGCCTTACTGCGCGATTTGCCCCCACCCTAACTGAGGCTGCAGG
TGCCATTATTGACACCCGATGCTCCAAGTCGAATCCGCCAGAACCTTGGAACTGGAACAT
TTACTTGTTTCCTTTATGGTGCTTGCGGGTTGTTGTTAGATATGAGATTCTTTTCCCCAT
AAGAGTTCTTGTCTTGACAATAGGATGGATAACATTTCTCTCTTGCTATATCCCGGTGCA
TTTCCTCCTTAAAGGGCACCATAAGTTCAGGAAAAAACTAGAGCACTCTATCTGGTGAAA
TGCTGAACAATTGGGTTCAAACAAGAGCAGGCACACTACTTTTTGAGGAAATCAATCTAG
TTCATAAGACTTCTGCAAATTATAGCAGATGTTGATACTGAAATTGGTTTTGGAGAGAGC
TTCACATTTATATACTGGTTTGTACTACTTGTTAAAGCTTCTTTATTTACACTACACTGT
TGGTGAAGATAATGGAAAGACTAGTTCTTTTAACTTGGCATATGGATAGAAATTACTGAA
ACTTGTGCTATAAAGTTTCCCAAGAAATAGGAATATGTTCCAAAACAAACAATTGAAGCA
AGCATGAGATTTCAGTGTATGAACAGAAATTACTACAGCTGCAGACATTAGGAAACACAA
TTAGCAATGGAACGCTTCATTATGTTGATTAGCTTTGGAAGTTGCTTATTGTGTCTGGAC
CAGGTTCTGCCACATTTGTGTATATGTTCAAGTATGATCTTGGATAAAAAATGAGGTAAA
GCACATTGAAACATTACATAAGGAATCTGCTATATCTGTCTCAATCATTAGCTTTTGCAA
ACAAAACTAGTCATAAAAGATATTCAGATACAGTATGGACTATGCCCATAGTTCTTTTTT
CTTTAGCTTAAGCTTCTGTCTGATTTTCTTTCTTTGTTTGGTCCACCAAACTGACCTTTT
TTCCTTTTCCTTAGTATCCGGTTAACACTTAAAACAAAAATCATCTAACAGAATGCGACA
GAGAAACTATCCCTATTTAGAAACTAATTCTCGGTATTTAGTGGCACCATGTATTATGGG
ATACTATCCCTAAAATTTTAGCAATCATGATGGAAACAAACCGAACCTACCAGTACTCTT
ATATATAATCAAAAGACGTAGTATTCAAATCAAAACAAGAATATTCTAATAAGAAATACA
ATGTTCAAATGAGTGCTCAACAGATATTCAAATCAACTTGAGAGTCAGCCACTGGCACCC
GACAGTGTCTTGACCCCCATCCAATTTGGGGCCCACCTGAGTAAGATAAATTGGCACGAT
TGTTTGGAAATTCTCTATTATGATTTAAGAGGTCTAGACTTGCTTATGTTGCACTTTTGT
TGTTCTCTTGAAGAGTATCTATACATACTAAGGTTTCTGGCATCCTTGCTTTGATTAAAT
TTCTTAGAGGATTCTGTTTGAGCTGATATGCAGTTTCTTTGTTGCATCTTGGACTGGGGT
TGTCAAATACCACGGCCCACGACCAAGCATACGACCTAAGCAGGTTTTTGTGGCAAATCA
CACGCCAATGATTGATTTCGTTATCTTAGAGCAGATGACTGCATTTGCAGTGATCATGCA
AAAGCATCCTGGATGGGTTGGATTACTGCAAAGCACCATTTTAGAAGGTGTTGGATGTAT
CTGAACCGCTCAGAAGCCAAGGATCGTGAAATTGTAGCACGGAAGTTCGTAATGTCAGAA
GAATCATTATAGACATCTCACTCTGCAGTGTTTTTCTTACATAATTTAATTTTCAGGTTG
AGGCAACATGTTGAAGGGGCCGACAACAACCCTCTTCTTATATTTTTTTTTTTTTTTTGA
TGACAAGGGAAACCCGTAGCCGCTACCCTTTGGGTGCACACAGGGTAAAACCCCTGCTCC
TATGCAATAGCTCGCAAACCACATAGGAGAGGTAACCCGCACTAGGCAAACCTGGTGCGA
CGAGCTTGACCCAGAAGGCAAACCCCTTGCTTTCGCTGGCAAGGGGTTTCGAACTTGAGA
CCTCCAACGTGGAAGTCCCAAGCTCAAATCACTGGGCCACCCCGAAGGGTGACCCTCTTC
ATATATTCCCTGAGGGAACTTGTGTAAATAACCACTACACTGTCATGTTCAAAAAGGGAG
CATTTGAACTCGGCTGCACTGTTTGTCCTGTTGCAATCAAGTACAACAAAAAATTTGTTG
ACGCCTTTTGGAATAGTAGAAAACAATCCTTCACAATGCACATTTTGCAGCTCATGACAT
CTTGGGCTGTAGTCTGTGATGTTTGGTACCTGGAGCCTCAGAACATAAGACCTGGGGAGA
CTCCAATCGAGTTTGCAGAGAGGGTGAGGGACATCATTTCTGTTAGAGCAGGTCTTAAAA
TGGTTCCTTGGGATGGATATTTGAAATACTCTCATCCTAGCCCCAAGCATCGAGAGAGGA
ATGAACAGTTTGTATGTCCAGGCAGCAGAATTTTGCAGAATCAGTGTTGCGTCGACTGGA
GGAGTAGTAGATAATTGGATGTATGTTTTTTGTCTCCATTTTCACTTTTGGCTTGAGAGC
CGTTCAATTTGGAATAGTTGTCATATTATTCTTCCTTGTCAGCTTGACGTTTTGTGTTTC
ATCACTTTCTCTAACCATAGTTAAAGAGTAGAAAGTTGACAGCAATTGTGTGTGAAGCTC
ATTGCTTAGTCTTTATGGTTTTGGATGTCCACGCAATCCTAAACTTTGTGACTGTCATTT
TGTGGTTACTCTTCCATGATGAAGAAGATACTCTGTGTGTGTGTGAAAAAGAGAGATGAC
TGCTCTCTCCAATGGTGGACAGATGGGTTCAAATTCCATCTTTGGGTAATTTTTTTTTTA
TGACAAGGAAACCCGCAGTCGCTATCCTTTGGGTGCGCATAGGGTAAAATCCCCGCTCCT
ATGCAATAACTTGCAAACCACATAGGAGAGGTAAGCCAGTGCGACGAGCTCGATCCAGAA
GCAAACCCCTTGCTTTTGCTGGCAAGGAATTTCAAAATTGAGACCTCCAATATGAAAGTT
TCAAGCCCAGACCACTCGGGCAGAATGCTGAATAAACTAAATAATGTTGGCTGTTGTTTT
CTTGTGCACGTGGTTTTCCCAGTCATTGTCGTTTGTGAAATTAATTGTTGGCTAGGGAAT
CCCAGAAGAAATTAAGACAAAGAGTTACCAACTCAAGTGTTTGTTTGTTTTTCCAAAGTT
TAATGATTCTTTTTGGTGGGAATATTTATTTGCCCAAAGTTTGAAACCCAAGGCCTGGAG
TAACAATCGCTGCAGCCTTTACGTTAGAAAGGAATTTCTTACAAATTCCAAAGACCTAAA
AGAATCATTTTAATTCCCATGATATGAATTACAAGACAACAACAACCTGAACAGAGGTTG
TCAGCTGGTCAATTTTTTCACACATGTTTGGCCTCTAATTATTATGATATAATAATTCCA
ACCCTTTTTCTCTATTTACATGTTTGATGTTGATCTTGTTTTAATGTGTGTTTTTCCTTT
TTCTCCTCCAAAAGTTGTTGCATATGAAGTTAAAGATAAATATTTGATACCATATAGTAC
ACTTTTTGACTGAGGGAAAATTTTGAACTTTGGGGACCCTATCTATACTATACTAGGACT
ATTCATCTTTTAGAATTTCATTTTCACCGTGAAGTTGGGATCCGTGTCAC