Microarray Probes on PGSC0003DMT400046765

Probe IDChipProbe Sequence
CUST_11866_PI426222305 JHI_St_60k_v1 CCACTGCTTGACTGGTATCTGTTCTTATGTTTTTAGGAGGTTCATGTTATATTTCCATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046765

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046765 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48200.1 +1 7e-119 382 217/365 (59%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 210 Blast hits to 148 proteins in 42 species: Archae - 0; Bacteria - 118; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). | chr3:17832949-17837371 REVERSE LENGTH=1088

Transcript Sequence (1888 bp)

>PGSC0003DMT400046765 1888 pgsc_dm_v3.4
GGTTCCATGTGCTACATCTTTTAGAACTGTCATTGTTGAAAGCTCGTGATTTGCAGATAT
TTTGTTATATGCCTTTCTTCTTTCCTTAAAAAAGGGACAACCTCATCAATTATTAGAAAT
TAGGCACCTGGTTGCTGCATATATCTAAAAAATGTCATCTAGGATGATAGTTCTTTAGCA
GCTTTATTATGATCCTAAATAATCCTACTACTGGCATGTACCCTTTGATGAGAATGTTCA
ATAATAGAGGAGATCTGCACACTTTACATTTTCTTTCTGCATCATTTCAAGATTTGTAAA
TCTTGTTTACGAAATCACAAATTTTGTTCTTATTTTCTTCTAGGAGGATCATCTGCAGGA
ATTGCTGTTGGCATTTTGCTGTTGGGATTAGTATCATTTCTATTGTTAGCATTATTTTTG
TTCCTCTCTATTGGAATAACATTAGGGAAGCTACTGCAGTATAAGGAGGTACACCAAGTA
GGGCAGAAATTCCATTGGTATGAAGAATTAGTCCGAGTTACCCTAGGTCCTGGTAAAAGA
GGTCAGTGGACATGGAAAAATTCGCGCGATTCTAGACATATAGTCATGTTTGGGCCTCTG
TTTGAGGATCTAAGGGGTCCACCAAAGTATATGCTCTCTCAGATTGCAGTAGGAAATCCT
AACAAGCATCCTGACAAAGTCATTGCAACAGACGATGAGACGGAAGATGCGGAAGCACCT
TGCATCCAGAAGGTGTTTGGGATTCTAAGAATATACTTCACATTTCTTGAATTTGTGAAG
CGTGTTTGTCTTGGAATTGTTGCTGGTACTTATTTGAAGAATTGGTCTTCAAAATCTCCC
ATAGTTGTCCTGCTTACCATCACTTCTTTCCAGCTATTCTTCATGCTTCTGAAGAAGCCT
TTCATTAAAAAAAAGGTTCAGTTGGTTGAGATCATCTCAGTTGCCTGCGAAACAGGTATT
TTCGCTGCTTGTATTGTTCTCATAGGAAGAGATTCGTCCAGAAATGAGACAGCAATCGGT
ATCACCATGCTTGCGCTTTTCTTCATAGCATTTTTATCTCAGCTTGGAAATGAATGGTAT
GCATTATACAGACAGACAAAGAGACTCGGTGCTGAAGACAAGTCTTTCTGCTCTGGTCTG
AAAGCAGCATCAATTGGATTCCTCTTGTTTTTCATTCCTCAAAGATTGATCAGAAAGCTT
GAAAGCGGGTCTGCACTGTTAGATCGTGTACTCAAGGAAACCGGGGATGTTACTTCATCT
TGTGACAGGAACCGGAGTTCTGGTAGTAGAAGCTCAGGTACTGATAGACCATGGCATAAG
CAATTCAGAGAACTAGCAAAGTCCAGCTTTAGTAAAGATAGTAATGTAACTACAAGTGAT
CCGTCAACAAGTCGTGTCAGATGGAGTGGATTTTGGAACCCTAAGAGAAGTGGGAGCTCA
TCAAAAGATTCATCAGCAGACTTCAAGTCAAAACCAAGAGGATTGCACAAAGATTTAGAA
GCTATTTTTGCTTCCAAGTCATAGACCTCTCTTATTCATACAACATTATGGAATACATGA
GACTAATATTCTGGCTTTACTGGTTACTTGACTACAAAGGTGGATCTGAAGCGGGTTCTG
TGAATTCAACTGAACCCTTTGCTTCTAGTTCGAACTATGTAACCATGTATTTGTATGCAA
AAAAAAGAAGAAGAAGAAGAAAATGTATACATATAATAAGACTACACTTATTCTGAACTC
ATTGACTTAAGTTTTACCTGAGCTTATGTATTTATATTTTGGATTGGATTTGCCACTGCT
TGACTGGTATCTGTTCTTATGTTTTTAGGAGGTTCATGTTATATTTCCATAATAATGTAT
AGCTCTCAAATATAAATGCATGTTGTCT