Microarray Probes on PGSC0003DMT400046380

Probe IDChipProbe Sequence
CUST_8700_PI426222305 JHI_St_60k_v1 CTGAGTCAAACACTTACAGCCCATTTATATGGGGTTTATGATGGACATGGAGGCTCTCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046380

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046380 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G57050.1 +2 3e-64 224 125/238 (53%) Protein phosphatase 2C family protein | chr5:23087720-23089303 FORWARD LENGTH=423

Transcript Sequence (2782 bp)

>PGSC0003DMT400046380 2782 pgsc_dm_v3.4
ATGATTAGTCTCTAATAACAAATCCTTGCATGCATCCTTTCTTGATTTGTTTGACTCTTG
AATTATATGGGGTTCTCACAAACCTTTTTTTTTTTTGATTCAACTAACTTTAGGTAATCA
AGAAGAAGTTGGGTTGCTTTGAATTTGGAAAAAAGTTTCATGTTTGGTCTGCTTTGAGCT
TGTAAGTCCTTTTTTTTTCAATAAAGTTTGAATCTTTATATGTTGTGTTCTGTCTTGTTA
AGCAGTGACCACTAGATTTGTTGTTTCCTATATATTATAAGTTGATAAAAAGTGTTTCTT
TGTTAAGGGGGTTTGTTGCTAATGTGTTGTTGAATGGATAGAATTGGAATAGAAGAGTAC
AAGATGCTGAATAGGGTTTTATGGATAGTGATTCCACAAGTTTGGACTTTGGATCCATAT
TCTCTTATGTCATAGATTTATTCTGTTTTTTTTTTATGTCAAAACTTTTCTTGGCTTACA
ACTTAAGTAAATTTTAGGGATTTGAATAATTTTGGTTGGTTAGAAGATGGAAGAGATGTT
TCCAGCACTTACTGTATCATATAAACAGGGAAAATTGATATATGATGAATCAGTATTACC
CACATGTATTGACTTCGCTGAATATGAGCTGATCCCGAATACGACTAGCTTGCTATCAGA
ACCTAACAAGTGCAAACTTCCTTGTTCGGTGTCGAATCATAGTGTGTCCAGGGACAAAGC
TAACCTCTTTATGACAGTTGCTGATTGCCATGAAATCAGGAAAGGGAAGAGTTTTTCTTC
GACAGTTGTAGCTAATGGGAATTGTTTGATTGCTAGTGAGGTAAAAGATGGTAGATCTAT
GGACAACAATTTGATTTCACCAACTGATGAGCTTTTAGGAAATATGACTTGTTCTGATTC
TCTAGTGGATGAGTGTGGCGGCATGCCTAACCAAGAATGTACAGATTTGGAGGTTAAAGT
TGGGAGAACTCCTCCTCGGAATGAAGACAAGAAGGTTGGTGTATCCCAGATTCTGAGGAA
GTCTTTTTCGTGTAATTTGGCTAAAGAGTTGGTTAATGAGTCAGAACTTGTAAGTGATCT
TGTTTCCACTATGGTTGTGGGTGCTGAAGATTATAAAAGAAAATTATCACCATCCCATCT
TGAGACCTCACAAGAGATAAAGATAAGTAGGCCAAATGCCTTTTGTTTTGATTCTGTACC
GCTTTGGGGGATCATCACGATACAAGGAAAGAGGCCGGAGATGGAAGATACTGCTATAGC
TTTACCAAGGTTTCTGAGAATCCCTTCCCATATTTTGACGGATGCGCCAGTTTCTCATGC
CCTGAGTCAAACACTTACAGCCCATTTATATGGGGTTTATGATGGACATGGAGGCTCTCA
GGTTGCTAATTATTGTCATGAGCGTCTCCATATGGTTTTAGCACAGGAGATAGATATTAT
GAAAGAGGATTCACATAATGGAAGTGTTAACTGGAAGGAGCAATGGTCAAAGGCTTTCTT
GAATTGTTTCTGTAGAGTCGATGATGAGGTAGGAGGGTTCTGTAGTGAAACAGACGGGAT
TGAGCCTGACCTTTCAGTCATTGCTCCCGAAGCAGTTGGATCTACAGCTGTAGTTGCAGT
TGTTAGTCCAACCCATATTATTGTTGCTAATTGTGGTGATTCAAGGGCAGTCCTTTGTCG
GGGAAAACTGCCCATGCCATTATCCATTGACCATAAGCCAAATAGGGAAGATGAGTGTTC
ACGAATAGAAGAATTGGGAGGGAAGGTCATTAATTGGGATGGACATCGCGTTTCTGGTGT
TCTTGCAGTTTCAAGGTCAATTGGTATGTATATTGTACTAGCCACACCTGCAAATTTCAT
TGTACTGCTGTATTTTTACTGGAGAGGGTTAAGAAAGTCATCTATATTGTGCTTGATTTG
CACATGGAAATAAAGGAATCTCAAAGCTACGATGGAGCAGACCTGCACATGTACCAAAAT
TAAAGTGTTATACCATACATATATAGTGTCAAAGTTCATCCCTGAAGCAGCCCACTGATG
TTGGATAACGACGTCTGACTTCAGTTGACATGGTTGTCATTTATTATTTGGAAACTGTTA
TCCTAGAGATCAAAGCTTTCTTGATTTGAAGAGGTTGTCATTTTACTGCAGGTGATAGAT
ATTTAAGGCCTTATGTGATTCCAGATCCAGAAATGATGTTTGTACCCCGAGCAAAAGAAG
ACGACTGTCTAATTTTAGCAAGTGATGGCCTATGGGATGTCTTGACAAATGAAGAAGCTT
GTGATGTGGCCCGGAGACGAATTCTTCTCTGGCACAAAAAGAATGGTGGTACTTTGAGTA
GCGAAAGGGGTGAAAATGTTGATCCTGCTGCTCAGGATGCTGCAGAGTACTTGACACGAG
TTGCTCTCCAAAGGGGGAGCAGAGATAATATATCTGTGATTGTGGTCGACTTGAAAGCAC
AGAGGAAATTCAAGAAGAAAACGTAGCGCACTAAACCATCCTCGTATTTCATTTTGTGGA
TGTAACATTGGAAACTTATCGTTCAGGATGATAATCAAATCAAATGGTACTCATGTTGCA
GATTTTAGCTTCCTTTTTAATTAGGCTGTTACCGTACATGATGGAAGTTATTCTGACAAT
AAAAATTCAGCAAAGTTGGTTCAAAGAACAAACTACTGACTCCCAGCAGATTATTTATGT
CACTATAGTATAATGTTGTCTCCCAGAACTCTCTCACTGTTTTCTGTTACCATTTCTTGG
CATGATATGTTTTGTTTTCCAC