Microarray Probes on PGSC0003DMT400045865

Probe IDChipProbe Sequence
CUST_50339_PI426222305 JHI_St_60k_v1 ATGAATGAGCAAGCCAAGGAAAAGTATGAAGATGCCAAAGAGAAGGCCTCAGATGCTGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045865

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045865 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G18340.1 +1 4e-40 150 142/418 (34%) late embryogenesis abundant domain-containing protein / LEA domain-containing protein | chr2:7969400-7971025 FORWARD LENGTH=456

Transcript Sequence (1296 bp)

>PGSC0003DMT400045865 1296 pgsc_dm_v3.4
ATGGGTAGCGGCGATGATGATTATGTGTTCGTGTTGGATGGAGGAGGCAGCGGAGAACGA
ATTTGGCTACCGGAGAGGTATCAAGAAGATGCAGCATCAGATGCTAAGGACACTATAAGT
TCTACCGCATACGGAACCGAAAGAGAGGCGACTCAGAAGGTTAGTGGAATGGTAAACATG
GCATCTGACGCTAAGAATGTTACTTGCGAGAAGGCAAATCAAGCAATGGATGCAGCAGCT
GAAATGGCTCATCGTGCCACCGAGAGAGGGAAACATAGTGCATTCAATGTATATGACTTT
GCATCTGAGAAAGCACGTGATATCGATAATAAAGCGAAAGAGAGAGTTCATTATGCTTAT
GCTTATGACATGGCAGCCAATGCCAAAGAAGGAGCCAAACATAAAGCTTCCGAGGCCTAT
GATTTCGCTGCTAAGAAAGTGGATGATGGAATGAACACAGCTTCCCAAGTGGGCAGGGAA
GTGAAGGATAAAGCTAACCATGCCTATGATTTTGCCACTGACAAAGCAGGTCAAGCCATG
GACAAGGCTTCAGACATGGTAGGTGAGGCCAAGGATCGCGCCAAAGACGCTTATAGATAC
ACATCTGATAAGACGAATCAAGCAAAAGACATGGCTTCTAGTAGTGCAGCTAATGCAAAA
GACACAGTGGAAGATAAAGCATCCGAGGCCAAGGATAGCGCCAACGATGCTTACAGGTAC
ATATCCGATAAGTTGAATCAGGCCAAAGACATGGCATCTAGTAGTGCTGTTAATGCAAAA
GACATAGTGGAAGATAAAGCATCTGAGGCCAAGGACGCTTATAGATACACATCTGATAAG
ATGAATCAAGCAAAAGACATGGCTTCTAGTAGTGCAGCTAATGCAAAAGACACGGTGGAA
GATAAATCATCTGAGGCCAAGGATCGCGCCAAAGACGCTTATAGATACACATCTGATAAG
TTGAATCAGGCCAAAGACATGGCATCTAGTAGTGCTGTTAATGCAAAAGACACGGTGGAA
GGTGAAGTATCGGATGCATACAACCAAACCATAAAAATGACTACTGATAGAAGTACTATT
GATGCAAAAGACTCGACGAGGGATGCATTGGTCCAAGGGAAAGATAAAGTTGATAAATAT
GAAGATGCAAAATCGAAGGTTTATGAAACATATAAATCTGCAAAGGATACTATGAATGAG
CAAGCCAAGGAAAAGTATGAAGATGCCAAAGAGAAGGCCTCAGATGCTGCTGGCAACCTT
GGCCAAAAGATGAGAACTGGAAGTACAGAACTATGA