Microarray Probes on PGSC0003DMT400043632

Probe IDChipProbe Sequence
CUST_1613_PI426222305 JHI_St_60k_v1 GCAGCTTTTGACAATCATTTCTTCTGGAAATCCAAAGGAAGAAACATTTCCTAGATCCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043632

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043632 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc06g051460.2 +3 0.0 1682 937/1065 (88%) genomic_reference:SL2.50ch06 gene_region:31369126-31374317 transcript_region:SL2.50ch06:31369126..31374317- functional_description:ATP-dependent chaperone ClpB (AHRD V1 *--- C0GC24_9FIRM)
TAIR PP10 AT2G29970.1 +3 0.0 598 434/1085 (40%) Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein | chr2:12776601-12779784 FORWARD LENGTH=1002

Transcript Sequence (3761 bp)

>PGSC0003DMT400043632 3761 pgsc_dm_v3.4
CCCCACCAGCAACAGCAACCACCACCAGTGTCAAGCACCATCAACAAACATCTTACCCCA
CCATCTCCTACCTATTCCCTTTCCTTTCCAAAAACCTCATAAATAACTCAATGTGATGGA
TACACTTAGCTTGAATGTTTCTATTAACACCTTCTGCCAATCTATATCTCTATTTTCTTT
CTTATACTAGTGGAGTGTGAGGAGTATTAAGGATTATATATATTACTACTCCGTACTTCT
ATTGTCAGCGCTTTTTTAAAAAATAAATTAATTTATGTTTTCTTGATTACATTCCGTACT
CTGTGTTCACGTTTACTACCACAACAACAACAGCAGAGTACTTCTTCTCTTTCTTTTTGG
TATTTGCAATGCCAACGCCAGTTAATACTGCTAGGCAATGCTTGACGCATGAAGCTTCCA
TCACTCTCGACGATGCTGTAGCCATGGCAGGTCGTCGTGGCCATGCTCAAACTACATCTC
TTCATTACATATCTTCCTTACTCTCTGTTCCTTCTTCATGTTTACGTGAGGCATGTTCTC
GTACAAGGAACAATGCATACTCTGTTCGTGTCCAATTCAAAGCTCTAGACCTCTGTTTAG
GGGTTTCGATGGATCGGTTGCCTTCGTCGCCCAGCAGCAGCAAGGTAGACTATCCACCTG
TTTCGAATTCTCTTATGGCAGCCATAAAGAGGTCGCAAGCGAATCAGAGACGACAGCCGG
AGAATTTCAATTTTTATCAACAACAGCTTCAGAATCAGTCAGCTTCTTCTTCTTCTTCTT
CTTCAGTTCCAGTAGTCAAGGTTGAGTTACGGAATCTCATAATATCTGTCCTTGATGACC
CTGTTGTAAGCAGAGTATTTGGGGAAGCTGGTTTCAGGAGTTGTGATATTAAACTTGCAA
TTCTTAGACCTGTTCATCAACTCTTCAGATATTCAAGATTCAAAGGACCACCCTTGTTTT
TGTGTAATTTAACCAATCAAACCGATCGAAGTTTTAGTTTCCCCTTCTTGGGATTCTCTG
GGGGAGAAGATGATTGCAGAAGAATTGGGGAGGTTTTCGTCAATAACAGAGGAAAAAATC
CACTTATTCTTGGTACTTGTGCACAGGGTGCTATGAACAATTTCCTTGAAATGATACAGA
GTAACAGAGGAGGAGGAGGAGGAATCCTTCCTGTTGAGGTATATGGATTGAGTGTGATTT
GTATAGAGACAGAGATCATAAGGTTTGTTAGAGGAGAATATGATGAGGAATTAATGAAGT
CGAAGTTTGAGGAGATTGGAAGTATGTTGATGAATAATAGTTTAGGGTCTGGTGTTGTTG
TCAATTACGGAGATTTAAAACTGTTATCAAGCAATGATGGTTATATTGATTCTTGCAGAT
ATATTGTTAGCAAATTGACAAGTTTGCTACAGATTAATCATGGAAAACTCTGGTTGATTG
GGTGGGTAGAAAAGTATGAGATATATTTGAAAGTTTTGAATAGATTTCCTTACATAGAAA
AAGATTGGGAGTTGCAGCTTTTGACAATCATTTCTTCTGGAAATCCAAAGGAAGAAACAT
TTCCTAGATCCAGGTTGATGGAATCTTTTGTGCCATTGGGAGGATTCTTTTCTACGGCAA
CTGGTGATATTAAAAGTCCGTTAAGCAGTTCATACCACACTGCATCCCGGTGTCACTTAT
GCAATGAGAAATGCAAACAAGAAGTAAATGCTCTCTCAAAATGTGGATTAATAAGCACTG
CTTCAGTTGCAGATCACTATCAATCAAGTCTGCCTTCTTGGTTGCAAATGACTCAACTCA
ACACTAATGGAGGACTCGACCCTATCAAGGCCAAAGATGATAAAATGGTATTGGGTGCTA
AAATTGCTGGTTTGCAGAGAAAATGGGACAATCTATGCCAGCGTTTACACTACAATCAAC
CATTACCCAAGACAAGCAACTTTCACATGACTTCTGAATTCCCATCAGTTGTAGGCTTTC
AAGTTGTTGAAGACCGAAAACAAAGTCTCAATAACGAAAACATTGAAACTAGGAGGAAGA
AAATGACTTGCACAATTTCTTCATCAAATGAAAGCAGCATTTTTCTCTCCAAAACGCGGT
CACAAGGTGATGATGACCATGGCTTCAACTCTTCAACCTCTCTAACTTCAGTCACAACAG
ATTTAGGTTTGTGCATGGCCTCTACTTCTCCTAGCAAAGAACAAGAGCACCTCACAAACC
ACAGTAGCATTAATCAACCACATGACATATCATGCAGTGTTGAGGCGCCTCGTTTCATTA
ACCGCTCTCCTCTTCAGCAGCAATTGGATCCAAAAGATTTTAAGATGCTATATGCAGCTC
TTATAGAAAAGGTTAATTGGCAAGAGGAGGCTGTAAATGCCATTAGCCAAACAATAGCAC
GGTGCAGATGTAGAAATGAAAGAAACAATTGTCCAAGTCGAGGAGACATCTGGCTCAACT
TTCTTGGACCTGATAAGCTCGGTAAGAAGAAAATTGCAATTGCATTGGGTGAGATTCTAT
ATGGAAGCACAAACAACTTAATCTGTGTAGACCTAAGTCTACAGGATGAAGTCGGGTTGT
TTGATCTTCAAGTATTGAATCAATACGACATGAGATTCAGAGGGAAGCATGTTGTTGACT
ATGTTGCTGATAAACTGAGGAACTGCCCTTTATCTGTTGTTTTCCTTGAAAATGTGGATA
AAGCTGATATACTGATGCAGAAAAGCTTGTCCCAAGCTGTTAAGACTGGTAGATTTTTGG
ACTCTCATGGTAGAGAAGTTAGCATAGGTAATGCAATCTTTGTGACGACGTCATCAAGAT
TAGATGAAGAAAGAACTCTTCCTTCTACCAAAGAAACAGCTAAGTATTCGGAAGAAGATA
TATTGGCAGCTAAAGGTAACCAAATCCAGATACTAATTGCATTTGATCTTACAGATGATG
TCAAAAGTCCAGACTCAACTGCATTGATAACAACTAGAAAAAGATCTTCTAGCCAAATCT
TTGTGAATAATAGAAAGCTTATAACTACTGGTCCAATCGAAAGTGTAGATCAGCAATTTG
GAAGCTCGGAGATGGCCAAACGAGCCCACAAGACATCAAACACATGCTTAGATTTGAATA
TTCCAGCTGAAGAGATTGAAAATTATGAGAACTTTACTGGAGATTCTGGCTGTGACTTTT
CCAATGAAAACACCACAGCATGGTTGAAACAATTGTTTACACAATTTGATGAGACCGCGA
TTTTTAGGCCATTGGATTTAGACTCTCTTGCTGAGAAGCTATTGAAGGAGATGAGACAAT
GCTTCCACAAAATTGTCGGTCCAGAATGTTTGCTAGAGATTGACTCAAATGTAGTGGAAC
AAATTCTGGCAGCAACATGTTTAAGTGACGGCAAGAAAATAGAAGATTGGATTCAACATG
TTCTTGGAAGGGGATTTGTAGAAGCACAAGAAAGATATAGCTTAAGTGCTCGATCTGTCG
TGAAACTTGTGACCTGCGAGAGCTATCTTCAACAAGTTCATATACCAGGAGTTCTCCTTC
CTGGCAGAATCATCGTGAATTAGCTAAAATCTAAGTTTCTCTATTTATAATATGTAATAT
ACAGTGTATTCACATTTTAGCACACCTAGTTAATTATGCTTGTGTTACCGGATTTATCCC
ATGTTTTATTGGGCTTGTGCGGGTCACGTTTGTTATAGTTTAAGCCATAAATTGTAAGAT
TTCACCTTAGCTAATTCAGGTATGAACTATTTATGTGTTAT