Microarray Probes on PGSC0003DMT400042632

Probe IDChipProbe Sequence
CUST_31537_PI426222305 JHI_St_60k_v1 AAGAGGTTTTCTTACCTAGAGAACTTAGGTATGTGTAGAAGTCCAACTGCACGTCACTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042632

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042632 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79860.1 +1 0.0 555 296/446 (66%) RHO guanyl-nucleotide exchange factor 12 | chr1:30042172-30044092 REVERSE LENGTH=515

Transcript Sequence (1407 bp)

>PGSC0003DMT400042632 1407 pgsc_dm_v3.4
ATGATTCTTGAAACGAACAATAATTCAATGGCTGGATTCAAGTCACGTTTGGCTAATGAT
TCAACGGTCACTAGCTCTCGTTCAGATATGGAGTTGATGAAGGAAAAGTTTTCAAAGTTG
CTCCTTGGTGAGGATATGTCTGGTGGAGGAAAGGGTGTCTCGTCTGCGCTGGCTTTGTCA
AATGCAATCACAAATCTAGCAGCTTCTGTTTTCGGAGAGATGAAAAGATTAGAGCCAATG
CCAGCTGAGAGAAAAGCAAAATGGAGAAAAGAAATTGGTTGGCTTTTATCTGTCACAGAT
CACATTGTTGAATTTGTTCCTTGTAGACAAGTATCAAAAGCTGGAACAAACATGGAGGTT
ATGGTAACAAAGCAGCGATCTGATCTTCAAATGAACATTCCAGCTCTACGGAAGCTAGAT
GCAATGCTTATTGATTGCTTAGATGGCCTTAACGATCAAAGTGAGTTCTCGTATGTATCA
AAAGATGATGAATCACAGGAAGAAACAAACAGCAGGAAAGATGACAAATGGTGGATACCT
ACTCCTAAGGTTCATCCTAGCGGCTTGTCTGATCCAATGAGGATTTGGCTGCAATTTCAG
AAGGATTCAGTAATCCAAGTTCATAAAGCATCCATGGCGATAAATGCTCAAGTCTTGTCA
GAAATGGAGATCCCAGAAAGTTATATAGAATCCCTACCTAAGAATGGGAGAGCAAGCCTA
GGAGATTCAATCTACAAAAGCATCACCGATGAATACTTTGATCCAGATTACTTCTTCACA
ACTATGGACATGTCTTCAGAACATAAAATTTTAGACCTCAAGGACAGGATTGAGGCTTCT
GTAGTTATTTGGAAAAGAAAGATGAATGCTAAAGATGGGAAATCATCCTGGGGTTCAACT
ATTAGCTTTGAGAAGAGAGAAATGTTTGAAGAAAGAGCAGAAGTCATCTTGTTAATTCTT
AAGCAGCGGTTCCCTGGAATTCCTCAGTCAAAACTAGACATTAGTAAAATCCAATACAAC
AAAGATGTGGGACAAGCTATATTAGAAAGCTATTCAAGAATAATAGAAAGCAGGGCATTC
ACAATCATGTCACGAATTGAAGATGTTCTCCAAGCAGATGCTATTGCCCAAAATCCTTCC
AATGGAGAAGTAAAGAGACCATTATCAGATAAAGAAGTAGGAAAGCTTAACTCTGCTGAG
AATGGAGCTTCATTGACACTTTTAGACTTCATCGGTTGGACACCTGATCAAGAAGACAAC
AACACAAAGAAAGATTTGAAGGAGGATCCAACTTATAAAGATATTAACGCGAAGATTAAA
TGCAACCCTTCTAGCATAGTCACCAACAAGAGGTTTTCTTACCTAGAGAACTTAGGTATG
TGTAGAAGTCCAACTGCACGTCACTAA