Microarray Probes on PGSC0003DMT400042617

Probe IDChipProbe Sequence
CUST_31504_PI426222305 JHI_St_60k_v1 GATACTGGTAGCTGCTTTGCTGTAACAAGAAATATTGGTAGTATTGTAGTACACAATTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042617

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042617 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G67300.2 +2 1e-39 146 69/95 (73%) Major facilitator superfamily protein | chr1:25193832-25196751 REVERSE LENGTH=494

Transcript Sequence (917 bp)

>PGSC0003DMT400042617 917 pgsc_dm_v3.4
TTAAGAAGATAACTGCAAATGCACAAATGCACAAACGCAATGGCCGGTTGTTTTCTTTCA
ATAATGGGAAATTATTTATGTTAGGTATGTGTTGGCATTTTCTTTGGGTGCTGGTCCAGT
CCCCAGCCTCCTGCTGTCAGAGATATTTCCTGGCCGGATTAGGGCAAAGGCAATGGCTTT
ATGCATGGCTGCACATTGGGTCATAAATTTTTTAGTCGGCCTTCTGTTTCTGCCGATGCT
TGAGCATCTTGGACCACAAATAGTGTATGCGGTCTTTGCAGGTTTTTGCTTGTTTGCAGT
GGCCTTTGTGAAAAAGAATGTGGTGGAAACAAAAGGAAAAACATTACAGGAGATTGAGTT
TGCCCTTCTTCCGTCTCATTAGTTGGTGACTAGATCACACTCTATATTAAGTTCAGATTG
GAAAATGTTAAGGTCCTAGAGATTGAACATCCAAATTCTTTGCTATAGCTATTTCTTGAT
TTGTACAATTTTGGAGTGTGTTCATAGGCAGGAAAGGCAGCAATGACGAACAATCAAGAT
AAAGATTGTCACAAAGCTAGTTTTCATAGGGCAATTGTCACTCTGCTTATTTTTGCTGCT
TTTCTGCTCACTCCACTGGTCGGTGACTATTGCCTGAGGGAGCATGAAACTGCATCTGCC
TCGGCCAGCAGTAGATCACATATATACTACAGAGTACCTATTGTTGTTATTTTTGTATAC
CCTTTCTTTTAATTTTTACCTTGATCTGATTTTTGTAACTAGCATGGCACAGAAAGGCTA
CTCTGAACATTCCTTACAGAAATAATGTTACAGATTTTGAATTAGAAAGATACTGGTAGC
TGCTTTGCTGTAACAAGAAATATTGGTAGTATTGTAGTACACAATTGATTAATGTAGCTG
AGATTTTTTCATATTTG