Microarray Probes on PGSC0003DMT400036997

Probe IDChipProbe Sequence
CUST_26477_PI426222305 JHI_St_60k_v1 CTGAAAATTGACGTTGAACCTGAGCTCCTTAGGGGATATGTCAACCAAGAAACTGGCAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036997

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036997 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62140.1 +3 3e-51 179 123/227 (54%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 24 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | chr5:24954563-24955376 REVERSE LENGTH=241

Transcript Sequence (1994 bp)

>PGSC0003DMT400036997 1994 pgsc_dm_v3.4
CACAAACTGAATAAGAAACAAATATCCGATTTTTAATATTAATATCCCTAAAATGCATGG
TTGCAATTATGCACAAGGACCCGACCACTTTGTCCACCTTGTGATGATAAGGTCCCTAAC
TCGTGGACACTAATTGGCCTTGTCGTCTCCAACTTGAGGTTCACATAAAAGGCAAACTAT
CTTCAAACTTTTAAACTTTCTGACTTAAGTAAAATTATCTCTCCATTTTCTCTTCAAAGC
ATAACATTAGCAAAATGGGGTCTCAAATTTACTCATCAACTCCTCAATTCTCCTACCAAT
TTCCCAAAATCAAACCAAGACAAGTATCTTCATATTCCTCACTTCATTTAAAATCAAGAA
TCAGCACCATAAGTTGTCAGCAACAGCCACAGTCTACTGGTGTTGTTACTGAAACACCAA
TTCCAAGAACTGCTACATACAATGTGGACTTCAAGACTTATGAAGATTGCAAACTTGGTA
TATCCAGATACCCAGATTTTGTGTATAATGCACAAGGGGGTACAGGTACTGGAACTGGAA
AAAGAATTGAGTTGAGCGATGAAATTTCAATTGATTTCGACTTGGAAAAGTTGTACATTC
CTCCATTAACATCTGCAACTGCTAAGTTCTTGGGATTGCCATTGCCCCCTTTTCTGAAAA
TTGACGTTGAACCTGAGCTCCTTAGGGGATATGTCAACCAAGAAACTGGCAAGGTTAATC
TGGAGTTCAAGGCCAAGTTCTGGTTTTCAGTTGGAACCATCTACAGAGCGCCACCACTGC
TTGTGGATACGTTATTAACATCAGACGAATCGAAGGGAAAAATTAGAGGAGGAAGAGGGG
AGAGGCTAAATGAAGAAGGAGGGTGTAAACTTATTGGGGTGGCAACAGTTGAACCTATTG
ACGACTTGTTTATGAATACATTCCTTAGCCTTCCAACAGAATGTCTTGCAAAGATGAATG
CTACAATCTCATTTTCCAGTACCTAGAGACTTTGCCAAGCAATAGTTATGTAAGATCACA
TTGTATAGCTCTCAAACATTGATATAAAAAGGAAGGCCAATAAATTGCATAGTTGATGTT
AAAGAACATTCAATGATGGATTTTGTAATACAGAAAGTGTAGAATTCATGGGAACCTGGA
CGTGAATGTCCATTGATACAAGATTTACAATATACTGCAATTGTACCAATTTTTACATCA
GCTGTTTATAGTATGTAAACTTTGAATACTTTGCTGTGTTCCAAAAGAAAAAGGGAGGAC
TTGTCCCTCTGTTTTACTTCCTGCTATATCCATCCATCCATCCATCCACAAGACTTTCAA
CACTCGAACCGTAATAATTGCTCCTTCAGTGCACAGTATCATGCTGCATCAAGGAAATAA
GGGTCAGAACATTCACGCGTAGTTGAACACAGTTAACCATTAAAGCAAGAAAACAAACTT
AAATTACCATAACTCAAACATGTTTTGCCTCTGAAATTGTTCTGATAAACTAGCAAAGCA
AAGTGCTATACATTATTCAAATGCGAGCCTCTGAGTATCAACCAGAGAAGCATATTGACC
CTTCCTTTCCAACAACTCTAAGTGTGTTCCCAACTCCGCAATCTTCCCATCAGAACACAA
AGCAATTTGATCTGCATTCTGAACTGTGCTCAATCTGTGAGCAATAACCAAAGTTGTTCG
TCCCTTCATCAGATGGTCCAGGGCTTCTTGAACTAGACGCTCACTTATAGTGTCTAAAGC
ACTAGTGGCCTGCAGAAAATACAGAAAGCAAGGCCATATTCATCAAATATATTTAGTATT
ACAATTAAAGGTGGATCCAGAAGTTGAGCTTTATGCATTCGAGTTCGGAATTTTACCACA
ACCCATTTGATCTATTGAGTTCAATTTCTTTTGAGGGGTAGGGGGTGGGGGGAATAATTG
TGAAATACTACCATAACAAGCAACAACATTACACCGAAAGAGCACCTAGAATTCATATCC
ACTTTCCAGGAACG