Microarray Probes on PGSC0003DMT400035991

Probe IDChipProbe Sequence
CUST_48598_PI426222305 JHI_St_60k_v1 AGACCCGCTTTTCCTCGTGGGATCATCAACCATGTTTACTAAGTTGTCAAATGCGGTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035991

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035991 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G51460.3 +3 4e-174 509 268/413 (65%) Haloacid dehalogenase-like hydrolase (HAD) superfamily protein | chr5:20902266-20904292 FORWARD LENGTH=385

Transcript Sequence (2337 bp)

>PGSC0003DMT400035991 2337 pgsc_dm_v3.4
TGAGACCTCTCATGTAACCTGTTGTTTTATTCATTCAAAGTTAATCAGAGAATGTATCTG
TTTCATTAATGTTAATAATTGTTTGTTAGTAGTTAGGCCCTTTAATAGGTTCACAGCAAG
TCATGCAGTGTTCCAATTGTATGCTATATGGAATCTACAGAAGCCTTGATTTGTCTTTTT
GTGTATGGTACTGATTGAGATTCTTTAAATTAGAATTCTTTCAAGTCTTGTTCTACTTTG
CTTTTCTTTTTTGGGTGCGACCTTTTCCCTTTTCCTGGTTGTGATTGATCTTATTATGCA
AATTGCTTGATGTTACAAACTTTCTAGACGTTCTGTTGCACTCTAGGTGCTGCATCACTT
TAACCTTTCACCTGTTTATTACATCTCTGTGATATTGAGACATACAGCTTCTTAACATAT
ATCCTTCTGATCCATATTTTGCAGTTTATTGACTGACTAGAAAAGTGAGGCTAAGAAGTG
GGAAGATGTGCAATTTCCAGGGATCTTTTGCTTGATGGACCATACGCCTGGCTGCAGTGA
TAAGGTTACTTTGAAGAAGTGGTTTTTCATTGACAAAAGGGTTGGTTAGAAGTGTGTGAA
ACAATTTAAGAGCAGAGTTACTCAAACCATTGCCAACTGCTTGCATAGTTTTAAAACTTG
TTTTCTGCCATAAAAAGATACTGGGCACAATGGACCTGAAATCAAATACATCCCCTGTTG
TCACCGATCCTGCCCCACTGACTCCGTCCAGATTGGGCATCCACTCAGCTTTGATGCCAT
ACCCTCCGGCTGGGCCAACTTTCTCTCCCACGCTCTTCCTTACTATCCCAAGGAAGAAGC
CTGGAATTCTAGATGATGTTAGATCAAACACTTGGTTGGTGGATGCCATGAAATCTTCAT
CTCCTACACATAGAAAGAAAAGTAAGGATTCCACTGCTGAATTAGCATCAAATGAAAATG
ATCTTGCCTACCGCATATGGATGCTCAAGTATCCGTCGGCACTTTCATCATTTGAGCAAA
TCACAAATTATGCAAAAGGCAAAAGAATAGCACTTTTTCTGGACTATGATGGGACTTTAT
CACCAATTGTAGATGATCCAGATCGAGCTTTCATGTCTAGTGCTATGCGTGCTGCTGTGA
GGAATGTGGCTAAATATTTTCCCACAGCAATTATTAGTGGGAGAAGTCGTGATAAGGTAT
ATGACTTTGTCGGACTATCTGAACTTTACTACGCTGGTAGTCACGGCATGGATATAATGA
GCCCTGTTCGAGCCATTTCTAATGACTATAGTTGTATTAGATCTACTGACAAGCAGGGCA
AGGAAGTTAATCTTTTCCAACCTGCTAGTGAGTTCTTACCAATGATCGAGGAGGTTCTTA
GATCTCTTGTTGAGCTCACAAAAGACATCAGCGGAGCAAAGGTTGAGAACAACAAATTCT
GTGTTTCAGTACACTATCGTAATGTAGATGAGAAGAGTTGGTCAACCATCGGAGAATCTG
TTGATGAATTGTTAAAACACTACCCCCGTCTGCGATTGACACATGGCCGGAAGGTTTTAG
AAGTCAGGCCTGTGCTTAACTGGGACAAAGGGAAAGCTGTTGAGTTCTTACTTGAATCAT
TGGGGTTGAATAATTGTGATGATGTTCTTCCCATTTACATAGGAGATGATCGTACAGATG
AAGATGCATTTAAGGTAAAGTTTAACAGACCCGCTTTTCCTCGTGGGATCATCAACCATG
TTTACTAAGTTGTCAAATGCGGTTGTTAACAGGTGTTGAGAGAGGGAAATAAAGGTTACG
GAATCTTAGTTTCTTCTGCTCCAAAAGAAAGCAATGCATTCTACTCTTTGAGGGATCCAT
CTGAGGTGATGGAATTCCTCAAGTGCTTGGTATCATGGAAGAAGTCAAGTTGTAGCAATT
AACTTATGGAATACATAATACCCCCATTTTGTTGGATTCTTTTCATATGAAGATGGAATG
ACTAGTTGCGGGGATGGTTTAGGGAGCAGAGGTGCTTAGTAAAAGTTTCTAGTGACGAGA
TTCAGGATATTCTAATTTACTGTTTCTTCTCAGAGCTTTTCTTTGTAAATTCATTTTCGT
AATTGCTGCATCAAGGATGCCCTTAGCCCAGCCAATGTATACTCATCGATCTTCATATTT
TGTTTTTTCCTTTTCTTCTTCTCTTTTTTATTTTGTTTTTAACTTTGCCTGCCAGTTCTC
CCCAAGGGAGAGTCTACCTGTTCGACATCTGAATTTCTTTATCTAGTAATTTATGTTCAA
GAGTTATTTTATTGCCCTATTCTATTACACTGCTTTGAAAATTGAATGTAATTTTCC