Microarray Probes on PGSC0003DMT400035281

Probe IDChipProbe Sequence
CUST_26811_PI426222305 JHI_St_60k_v1 TAGCTCATGAGGGGAGGATAAGATATTAAGGAGTTAGTCCCTTCGATTATAAAGTTATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035281

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035281 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G21760.1 +1 2e-52 179 86/169 (51%) UDP-Glycosyltransferase superfamily protein | chr3:7667099-7668556 FORWARD LENGTH=485

Transcript Sequence (787 bp)

>PGSC0003DMT400035281 787 pgsc_dm_v3.4
CGGCAGCCGCAGGGCAAGGGTGAAATAGGTGCTTCGGACGATGTTGCACGTCAGGAGCAA
GTGTTGCCGGATGGTTTCTTGACAAGAACTATGAATAGAGGGAAAGTGATTGGATGGGCA
CCTCAAGTGGCGGTGCTATCTCATAGGTCGATTGGAGGATTCATAACGCACTGTGGTTGG
AATTCAATACTGGAAAGCTTGTGGTTTGGAGTTCCGATAGCAACATGGCCTATGTATGCA
GAGCAGCAAGTAAATGCTTTCGAGATGGTGGTTGATTTAGAGATAGCCGTAGATATAAAG
ATGGAGTATCGAAGTGAGAGTCCGGTTTTGGTCACAGCAGAGGAGATAGAGAATGCCATA
AGGAGACTGATGTTGGATAGTACAGAGGAGAAGGATGGTATCAGAAAGAAAATGGAAGAA
CTGAAAGACAAAAGCAGGAAGGCCTTGTTAGAAGGTGGATCATCTTACTGTTTTCTGGAG
AGTTTGATCAATGAGTTTAAGGACCATTCGTCCAATTGAAGGTCTTAATTGCTTTCTTTT
ATGAATGTCGAGTACGTAAAGCTATGACACATGAGCCTAACTAAACCTCAAAAGCTAGCT
CATGAGGGGAGGATAAGATATTAAGGAGTTAGTCCCTTCGATTATAAAGTTATAATCTAA
AATTGCTCTTCTTTTTAGTAGATATTTAAGCGAAATTTTATAATGCTTCATAAGTTCGTT
GGTTTCAGGATCTTAATTATTAAGTGCACATTTTTATGTTTAAACCACTTAATGGATCTA
AATTCGC