Microarray Probes on PGSC0003DMT400029823

Probe IDChipProbe Sequence
CUST_27734_PI426222305 JHI_St_60k_v1 CATATAAAGCATTCGCTGGCAAAGACTCCAAGAAGTCTACATTAGAGATGCCTCTTCGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400029823

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400029823 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G08750.1 +1 3e-12 62 39/99 (39%) Peptidase C13 family | chr1:2801283-2804392 FORWARD LENGTH=388

Transcript Sequence (306 bp)

>PGSC0003DMT400029823 306 pgsc_dm_v3.4
ATGGAGACGATACACAATGATTCTGCATATAAAGCATTCGCTGGCAAAGACTCCAAGAAG
TCTACATTAGAGATGCCTCTTCGGCAGTCCAGCCAAGACTTACGACGAACACTTGCAAGT
TCAGATGTTCAGTATCCAACTAGTGACTCAAATGTTGAGGATCAACAAGATTCCTGTCCT
TTCACAAACTTTTGGATTTCTATGCATGGTAAAATGAGCAAGGTTGAGGGTCTTGATAGC
TGGGTGAACTATGGCTTGTTTTTTATGTTTCCAATGGTGGCAATGTCTTCTTGGATCTCG
TCTTGA