Microarray Probes on PGSC0003DMT400025890

Probe IDChipProbe Sequence
CUST_7815_PI426222305 JHI_St_60k_v1 CTTTCACAGCAGAGACTACCTGATATTGCAACATTATTCAGCCAGTTTCTGTTTTATTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025890

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025890 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54850.1 +2 2e-15 76 43/118 (36%) HSP20-like chaperones superfamily protein | chr1:20454440-20455994 FORWARD LENGTH=206

Transcript Sequence (1968 bp)

>PGSC0003DMT400025890 1968 pgsc_dm_v3.4
TAGGATTTGATTTTCAGTTCATTTTTTTCCACTTGTTAATTGACATTTGATACACTTTGG
AAAAGATTTTGGTCTAGGGTTCATTCTTTTAGATATCAGGTAATGTTCCTTACATCTTAG
CCATGATGAAGAAGCTGATTTTTTTTTTGTTTCTGGCGATTGACCAATGAAAAGCATTTG
TGTTCTTCTTTATTTAAAGTTTTTGCTTGATGGCTTTCTTATCCTATGATCTGTTTCTTT
GCTATCATCTCTTAGCACTAGGAGGAGCCATGGTAAGTTGTGGCATTTTTTAGGAATTGT
ATTTCAACTCATTTTTGGCTTTTTCAGTTGCTATATGATGCCACGTATATGATCTAAGGT
TTCTTGTCTAACATGTCTAGTTGGTGGAGAGGGAACTAGTATAAAGCGGAATTCAGACCG
GAAAATGCATAGGGTGATGAAATTACATGAGCTTTGTCTAAAATTAGGAGTATAAGCAGA
ACAAAAGATATATTAAAGCTGGATCACTTGTTTCTTCCACTTTGATCTTGGATCTATATC
TTTGGAAGTACCATTTAATGCGTCTATTTGCTGCTTTAAGTAGGCATTATTTGAAAAATG
ACATCTACTAGATTTCTGCTTTTGAAAGATCTAAACAACAGTTCAACATTCAGAATCATA
TAGAAGGCTAGGCAATGTTGTTGTTATTAGACAGAAACCATAGTTCAGCATTAAATTATA
GACATTAAGCATGAGATTATGATTCTTAATTATGTAAATCCTCTTTGAAACGTATGAAGT
GCTGATTAGTAAACTGAATTGCTAATGTCTGTTCTACCTTCGAGAACAGTGCATGAATGC
TGCTAACTTGAGAAACTAACAAGACTACTCTTGACATAGAGCTGATTCAACCATTTACAT
GTACAGAGTTTCACTGAAAACCTCACTGGATTCCCAAATCCCTAGTTCTTTTTATCTTCT
TTTGCTCAGTAGAACCCTCTGTGAGTTCCAAAATAGTGCTTTGCATTTCTGCAGAGCAAG
GTATGCAAAAAAGGCATTTACTTCTGTGCTTTAAAATTTTGTGCTAAATCCCCATTCTTC
GAACTGGCATGTTAACTCATAGCATGCCTAAGATATCGTGTATATTAATGTTATCCAGCC
GCTGTGACTTGTAGTGCGATACGCCAATCTTCTATTTTTACCGACATTGTACATATATTA
AGTTGCCAATTGAGTTCCTTCCTTCTTCCAGTATTCAAACAATGCATATTGTTCAAGGTT
TTAATACACTATAGTTTTACAATCTGCAGGAAGAAATTTCGAAGGAAACACTGAAAACTT
GAATATGATTATCGCATATCCATTTACATTCAACGCACATGTCATACGGACTGGAGCAGC
CCGAGAGGGGAGAGAAGGAGATTCTAATGATACAGTGACTATCACTATAACTGCAATTTC
ATACAAGTTTGAGGTTGTCCTACCGGCTGTTGCAAGAAGCCTTGGCAATTTGTCAGTTGT
TGTTCTTCCTAATGGGAATGTCAAGGTAGAAGGGATTGTAAGAGCTGGGGAAAGAACAAG
CAGTACGGCGCCAACTGTATTCAACAGAAGAACTCGACGGATATTTCCTCTAGGTCACTT
CACCATCAATTTCACCTTGCCAGGACCTGCTGATCCCACAATTGTAAGGGCCAAGTTAGA
CTCAAATGGTGTTTTGAAAGGAACTGCGTTTAAACGTTGGATTGGTAGGTCTGGTTAAAT
TGATGAGTCGTCTGATTAATTGGACATGGTTAGCTTGTAATCTTAATTAAAACCATCTTC
CTACTCTGGAGAATCTTTAGTATTATGGCACTGAAATTCTGTCTGCATCAATATCTTTCA
CAGCAGAGACTACCTGATATTGCAACATTATTCAGCCAGTTTCTGTTTTATTTTATATAT
ATGGTGTAAACTGTTTTTGTTATGTTAGCTGCTTATGGACAATTCTTG