Microarray Probes on PGSC0003DMT400016178

Probe IDChipProbe Sequence
CUST_36342_PI426222305 JHI_St_60k_v1 GGCATACAATTACATATATCTAATGCTTCCGCTTTGGCCTTCTTCAGTTTTTATTGCAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016178

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016178 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G44380.1 +1 1e-31 121 69/170 (41%) Cysteine/Histidine-rich C1 domain family protein | chr2:18323590-18324333 REVERSE LENGTH=247

Transcript Sequence (1054 bp)

>PGSC0003DMT400016178 1054 pgsc_dm_v3.4
CAGCTACGTAACTCTCCAATGTATCTCTACTATATTGCACAACAAAATTGCAAGGAAAAA
TAAAACACAATGGGAAGATTGAATGGGGGTACAAATGCGGGTAAGGAACACTTCAGCCAT
GACCACATCTTGAAACTAATTGCCAATCCAACTGAAACTCTCACTTGCAATGCTTGTGAG
CAACCAAACAATACTAACAAGCCTTTCTACGGCTGCAACACCTGCCAATATTTCCTCCAT
GAAAACTGCTTTAATGCTCCGCGTTTTCTCAATCACTCGTCTCATCCTTCCCACCCCTTG
ACCCTTCATCATCCGCCTTACGCGGGTGGTTACTATATTTGCAATGCTTGTGGGTCTGAT
GGAAATGGATTTTGCTATAACTGTGCTGCTTGTGATTTTGATATTCACTTGCAATGTGCA
TCATGTCCTAGCTCCATACTTGTTGATAAGCACACGCATCAATTGGAGCTCCACTTCGGT
TCTCCTGACGAAGACAAGGATAGCAAATATGTTTGCGATATCTGCTTTGTAACGATGAGC
AATGACAATTGGTTGTACTATTGCGCTGGCTGTGATTTTGCGTCACACTTGTACTGTGCG
ATAACTAGTCCTGAAGTCGGTGTTTTCCCCAAACAGCAACATCCAAATCCAAATCCAAAT
CCAAATCCAAATCCAAGTCAGAATTCGAATTCAAATTCAAATTTAAATCCAAATGCGGCG
GTGGAAATGATAAATTCAGTGAATGATGATCATGACCGGCTTATAGCAGCTCAAATTCGC
GCTCAGATAGCGGCACGAGGAAGACGGGCTGCTCTGGACTTAATCTAGGCATACAATTAC
ATATATCTAATGCTTCCGCTTTGGCCTTCTTCAGTTTTTATTGCAAAATAAATGCTTTAT
TGTTGTTATCATGTTATTTCTCTTTCAGATTTGTATCTTTATTCATCAAGTTTCTCCATT
TTTGTTTTGGTTGCTATGTTATCTATTATAAACTAGTGTTTGATTTTTCCCTTTTTTGTT
CTGTTTTCTTGGGTCCAAAATTAATGCCTTTGGC