All Microarray Probes on Gene DMG400006322

Probe IDChip nameTranscript IDProbe Sequence
CUST_36342_PI426222305 JHI_St_60k_v1 DMT400016178 GGCATACAATTACATATATCTAATGCTTCCGCTTTGGCCTTCTTCAGTTTTTATTGCAAA


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400006322

Click here to view details at Spud DB Genome Browser (opens in new window)