Microarray Probes on PGSC0003DMT400015269

Probe IDChipProbe Sequence
CUST_38815_PI426222305 JHI_St_60k_v1 GGATAGGAATAGTCCTTACTGGTATCTTGTATGTTGAGAAATCTGGCAAAATGTATATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015269

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015269 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G71010.1 +2 0.0 772 421/774 (54%) FORMS APLOID AND BINUCLEATE CELLS 1C | chr1:26782839-26788712 FORWARD LENGTH=1648

Transcript Sequence (6060 bp)

>PGSC0003DMT400015269 6060 pgsc_dm_v3.4
CCATCAAAGATTGGAACTTTAATCTTTTTTGTGTTTTCTTGATCTGGATTCTTTTGTTTT
GACACTTTTCTGCTTGTGGGGTTCTTGTTTTTTGGGGTTTTGGTTAGTTTAACTAGTTTA
TTTGGGTACCAAGCTCTGGATTTTGTGTTTCTTGACACTTTTCTGTTGGTGGGGTTCTTG
TTTTTTGGGATTTTGGTAAGTATAACTAGTTTATATGGGTACCTAGCTCTGGATTTTGTG
TTTCTTGTAATGAAAAATTGGATCTTGGGAACTATTGTTGATGATTCTGGGATTGGTTGA
GCTTATGTGTTTAGGTTTGAATATCTATAGATTGGTCAAAAGCACTTTAATTTCACTCCT
TATTTGTTTTCAAGATTTTATACTTCCAGGTCATGCCATTGGTGTACATACCATACTTGG
TGTCACTCTAAATTGCTGTAATCTGTTTTCCCCCTTTCCAATAAATAGTGATTTCTGGGG
GAATTTTTTTTTCACATACATTCTTTAAAGAAAAAAGATTATATACTTTATGTAAATTGC
AGAAAAGAAAAAAAAACCCCATTTTTTGTTGTGGGGTTTGATAGTTTCCATTGTGTTTAG
ATACAGATTAGGAGAAAAAGTTATGAACTTTGATAAATTGAGGCAGAATTGTGTTGTCAT
TCTTGGTGGGGTTTACTCATTACTTCCAGTCTATGGGAGTATCTGAAAGTTCAATTTTTT
ATTTGATTGAGAAAGTTAAATCTTGGATTTCGTGGGGAACGAGTGGATTAAACATGGATG
TGGACAGTGGAAAAACCTGTTGGGAATGCAAGATGAGGTTTACTGATTCTTGCAACAAGT
ACAATTGCCAAATTTGCAATGGAATTTTCTGTGGTGATTGTTGTACACACAGTAATGGAT
GTTTGGATGTTGTTGCATCTGGATCAGAAGGGGAAGTGGTTGATATAAAATCTTGCAAGT
TTTGTTCTGAGTTAAGGACTTGGAATAATGGTGTTGGGAAGTATAGAGACAAAACTTATC
CTTTTGAGTCTCCTAGAGAAAGCACAGAATCAACATCACCAAATTTCAACAGTGACAGAT
TTGATGGTTATTCTTCACATACACCAGTTAAGAGTAGTTTTACAACCTTTTCAAGTCATC
CGTCTCAGATGTCTCTACGTCACTCGCCAAGCAGGAGTGATGAAGATGAAGGAGGGGATT
CAACAAGCCAATTTTTTAGTCCATCAAGTAGCTATTTTCATGATACTTCAGATATAGATT
CGAGTAGTGTTAGTACTAGACATGAATTTTACAGTTTAAGGTCAGCTGGATCAAGTCCAT
CGGACAGCCCCTCTAGGATTCGTTTTACTTCCAATAGAGTTGGGCATTCTGTACAGCAAG
ATCAAAATGAGATCCCAAGGTCTCAGAATAATGGTCCCTTTGATCAACAAGCCTTGTATG
TTTTAAGAAGGTTTGAGAAAGGGACGAAGGATCCAGAGACTGCTGATGCCAGTGTTGAAA
ATTTGTCGGTGTATCACAACCAGTTAGAGAAGCAGCAAAAGCCGTTCGATCTTAGAAATA
GTGATCTCATATGGTTTCCTCCTCCACTTGATGAAGATGATGAGGATGAAAATAATTTCT
TCACATATGATGATGAGGATGATGAAATTGGAGAATCTGCTACAATATTTTCTTCAAGTG
CAAGCCTTACCACCATGGATAAAGAGCATGTGGATCACAAGGAACCTATGAAAGCTGCTG
TACAGGGCCATTTCAGGGCTCTTGTCTTACAGTTATTGCAAGGTGAAGGAGTAGAGTCGG
GGAAAGAAAGCGATTCTGATGACTGGGTTGACATAGCTACATCACTAGCATGGCAAGCTG
CGAATTTTGTGAAGCCAGATACTAGTGAAGGAGGCAGCATGGATCCTGGTTATTATGTAA
AGGTGAAATGTGTAGCTTCTGGAAGTCCAAGGGAGAGCACCCTTGTTAAAGGAGTAGTCT
GTACGAAGAATATTAAACACAAGCGAATGAATTCACACTGCAAAAATGCTAGATTGCTTC
TGTTAGGAGGAGCACTTGAGTACCAAAAAGTTCCCAATCAATTGGCCTCTTTTAACACAT
TATTGCAACAGGAAAGGGAGCATCTGAAGATGATTGTTTCAAAAATTGAGGCCCACCATC
CTAATGTGCTACTTGTGGAGAAAAGTGTATCTTCTCATGCTCAGGAGTATCTACTGGAAA
AAGAGATCTCTTTGGTGTTAAATGTTAAGCGGCCACTGCTGGAGCGGATAGCCAGGTGCA
CTGGTGCTCTTATAACCCCGTCCATCGATAACATAGCCATGGCTAGATTGGGATATTGTG
AGCTCTTTCATTTAGAAAAAGTTTCTGAAGAGCATGAACCTCCAAACCAGTTCAACAAGA
AGCCATCAAAGACTTTGATGTTTTTTGATGGTTGTCCCAGGCGTTTAGGTTGCACGGTCT
TGCTGAGGGGTCTGTGTTGTGAAGAGCTCAAGAAGGTGAAGAATGTCTTCCAGTATGCCA
TCTTTGCGGCATATCATCTGTCCCTTGAGACATCATTCCTTGCGGATGAGGGTGCTAGTC
TACCTAAAGTTTCCGTTGCCATACCAGAGATGACATCTGCAGATAGTGCTATTTCAGTGA
TTTCTCATACTGCTTCCCCGGCAAGACACCGTAGAGTTGGTAATGGCCCACATAACCATG
TAGGATCTGCCAGCTGCAATGCAGACATTGGGTTACCAGTATCGTTGGTGAAGCATCATT
ACCCTCCTTTTAAAGATCCAACCACCCTAGATGATACCATTGAAGGATCACGAGTAACTT
TAGGTCAAGGGGAGTTTCAACCAAGAGAATCGCCAGATCTGTCAAAGCTTGAGATATCAG
ATGAATTTGAACCCTCTAGTGAATCATATTCAGCTGCTGACAGTCGTCAAAGCATACTAG
TATCATTTTCAAGTCGATGTATTCTAAATGGAAGTGTATGTGAACGTTCTCGGCTTCTTC
GCATAAAGTTTTATGGATCTTTTGACAAGCCACTCGGGCGATTTCTTCTGGATGATCTTT
TTGGTCAGATACATTCCTGTCAATCATGCAAGGAGCCAGCTGAGGACCATGTCATTTGTT
ATACACACCAGCAAGGGAACCTTACTATACATGTTAGACGGCAACCCTCAGTGAAGCTGC
CTGGTGAGTGGGACAACAAGATATGGATGTGGCATCGATGCCTCAAGTGTGCCCATATAG
AAGGAGTCCCACCAGCAACTCACAGAGTAGTAATGTCAGATGCTGCTTGGGGACTCTCAT
TTGGTAAGTTCTTGGATCTTAGTTTTTCAAACAATGCAACTGCCAACCGTGTTGCTAGAT
GTGGTCATTCTCTCCAACGGGACTGCCTCCGGTTTTATGGGTGCGTACATCGTAACATAC
CTTAACAATGTAGTTTGTCGTCTGCCAGTAATGTGCAATCACTCTGATCATTCAATTGTT
GGATTTGCAGCTGCTATTTAGAGAATAAAATTTCCCCATTTGCCTTTACAGGTGTGGAAG
TATGATTGCATTCTTCCGCTATTCTCCTATTGATATTCTGTCAGTTTGTCTACCTCCATC
AACTCTTATGTTCAGTAGCTATGAAGAGCAGGATTGGTTACGGAAAGAAACAGATGAGCT
ATTGTGCAAAGCCAAAGCCTTGTATGCAGAGATATCCAGTGCTTTTCGCCGGATTGAAGA
GAAAAGATCCTCTTTAGAACATGATCTCTCTGATAAACCTGAGCTGGATGACTGCATCAT
GGAGTTAAAAGACTTACTTATGAAAGAAAAGAGCGATTACCATGACTTGCTTCAAACTGC
TGATGCAGAAACTTCAGAACGAGGGCAGGCAGTGGTTGACATTCTTGAACTAAATCGTTT
GAGGCATTCCCTTGTGATTGCTTCACATGTTTGGGATCGTCGTCTTTTATCTGTGGAATC
TCTCTTCCAAGAGACCTCTGGTTCAGAGTATACTGGATCTTGTAGTGAGCTGATAGATTG
GAGAAATGACCCTCTCGAGCATGTCTATGAAGAGACCGAACCTGAATTCTCAAACTTAGA
TGAATATCGTCAGAAACCTTTTCAGTCTGAACAGGAGGAGACTCATGGGTCAGAAGAGTC
CATGTTTACCTCATGTGAGTTCGAGAAAATGCAGGACATGCATATGGAAGGAGAAAATGC
AGTTAATGGAACACCCTTGGAACGAGCTCCTTCAGCTGGTTCTGTTCTTTCTGATCAGAT
AGATTCTGCTTGGACTGGTACTGACCGATCTCCCAAAAAAGCTCTGTTAAATATAACATT
AAAACGAAATGGATCTGAAGCTGCTCCTTTCAGACAACTGAGTCAACTTGATTATCCTCC
TATTGCAAGGGTTAAATCACCAGCACGAGTTAACTCCTTCGACTCTGCACTGAGACTTCA
AGAAAGAATCAAGAATGGATTGCCGCCTTCACTGCATTTATCAGCAATTAGATCTTTTCA
TGCTTCTGGAGACTATAGAAATATGATCAGAGACCCTGTTATCAGTGTTCAGAGAACTTA
TTCTCTAATGTCACCTAATGAGGCTCAGAAGTTTAATCTCCTAATGAATTCATCACCCTC
ATTTATTTCTTATGCATCTCTTATACATGATGGACCCAGGTTAATGGTTCCACACAATGG
CTTCAATGACATTGTAATAGCTGTTTATGACAATGAACCTACTAGCATAATATCGTATGC
TCTTATTTCCCAAGAGTATAAAGAACGGGTGACTGATAAGCCAAATGTGGCTGAAAGGGG
TTGGAACACGAATGGCCTCAGGAAGGAGAATGGATTGGCCTCTAATGTTTCAAGATGGCA
GTCTTTTGGCTCTCTAGACATGGATTATCTCCATCATGGAAGCCATGGTTCTGAAGATTC
TTCCAGTACAATTAGTTCCATCTTTGCAGATTCCAAGACCTCCCCTCACCTAAGGATCTC
TTTTGAGGACGAATCTTCAAATGCTGGCGGAAAAGTGAAGTTTTCTGTCACTTGTTACTT
TGCTAAGCAGTTTGATGCTCTCAGGAAGAGATATTGTCCTGATGAACTGGACTTTATACG
GTCTTTAAGCCGTTGTAAGAGATGGAGCGCTCAAGGCGGAAAGAGCAATGCTTATTTCGC
TAAGTCATTGGATGAAAGATTCATAATAAAACAAGTTCAAAAAACTGAGTTAGAATCTTT
TGAAGAATTTGGACCCAACTACTTCAAATATCTAACAGATTCTGTTAGCTCAAGAAGTCC
AACTTGCCTTGCTAAAGTTCTGGGAATATATCAGGTTTCAGTCAAACATTTGACAGGAGG
CAGGGAAACGAAAATGGACTTGATTGTGATGGAGAATCTCTTTTTTGGAAGAACAATATC
TAAGGTCTATGATCTTAAGGGCTCTCTAAGGTCCCGTTACAATGCAGACACAACTGGGGA
AAACAGTGTGTTGTTGGACATGAATCTTTTAGAAACATTGCGTACCAAACCTATATTTCT
TGGAAGCAAAGCAAAAAGAAGTCTGGAGAGAGCTATTTGGAACGATACATCCTTTTTAGC
GTCGGTTGATGTGATGGATTACTCTTTGCTAGTTGGTGTGGACGAAGAGCGTAAGGAGCT
AGTCTTAGGGATCATTGATTTCATGAGACAATATACTTGGGACAAGCACTTGGAGACATG
GGTTAAGGCATCCGGCATACTTGGTGGACCAAAGAATGCATTACCAACTATTGTTTCTCC
GATACAATACAAGAAAAGATTCAGAAAGGCGATGACAAGCTATTTTCTCACCCTGCCTGA
TCAATGGTCATCTTGAAACATCTTAAATTCATTACAAGAACTTTATATCAATAAGCAAAA
CCAAAATGGCATTTGCAAAGATCAGCAGGAAGGAAAGTTGATAAATTCCAGTTGATCCAT
TATGTTCTTTTTTTAGTGTAGGATAGGAATAGTCCTTACTGGTATCTTGTATGTTGAGAA
ATCTGGCAAAATGTATATCATTTACAGACTTCATCTAGAAAATTGATCTCTTTTAGCAAA