Microarray Probes on PGSC0003DMT400014688

Probe IDChipProbe Sequence
CUST_6350_PI426222305 JHI_St_60k_v1 AAAGTTTCTAACTTTACCCCCAATTTCAAGAACCCCAAAGTCGTTACAGCCTGCATGGCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014688

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014688 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G18270.1 +2 1e-175 508 270/409 (66%) cytochrome P450, family 77, subfamily A, polypeptide 5 pseudogene | chr3:6262010-6264025 FORWARD LENGTH=410

Transcript Sequence (1756 bp)

>PGSC0003DMT400014688 1756 pgsc_dm_v3.4
TTTCAATCACAGTGTCAGCAGAGGACAACTATAAGAACAAAGTTGGTCGATAATCACTAT
GACATTTTTTGAAATCTTCCCTTTTCTGTCCAAACGCCAATCAGTGAAGCTCAAATTCAC
TATTTACTGTAATTCATAGAAGATGGATCGTATTGGGCTTACTCAAAACTACCAATCTCA
CTGTTTCATTCATTCTACTACTTCTTTACACACCCAATTGTCTAAAGTTTCTAACTTTAC
CCCCAATTTCAAGAACCCCAAAGTCGTTACAGCCTGCATGGCGGCAGCGACGCCGTCGGT
GGCACCCACAGCCACAAGCTTTGGGTTCAAGAATTTGATGGAAACAGTGACAATTGATGT
TCATAAAGCGGAAGGGAGGCCACTGAATGTGCCACTGATAGCTCCTTTTACTATTGCTTC
ATCAAGATTGGACAAAGTGGAAAACGTAGCTATAAGGGTTGAGTTGAGTAATGGCTGTGT
TGGGTGGGGTGAAGCCCCAATTCTTCCATTTGTGACTGCAGAGGATCAAGCCACTGCCTT
AGCAAAAGCGGCTGAAGCCTGTGAGTTCTTGAAGCAGAGCCGTGAAATGACTTTAAATCT
CGCATTAACAAAAATTGGCGACGTGCTTCCTGGCCATGATTTTGCTTCTGTCAGGGCAGG
AGTTGAGATGGCACTGATTGATGCAGCGGCGAACAGCATTGGAATACCTCTGTGGAGACT
ATTTGGTGGAGTGTCTAATGCAATATCTACTGACATTACAATTCCGATAGTTTCACCCAT
GGAAGCTTCTGAACTGGCTTCAAAGTATCGTAAACAAGGTTTCAAGACTTTAAAGCTTAA
GGTGGGCAAGAATTTGAACGGAGACATTGAAGTGCTTCAATCCATACGTGCAGCACATCC
TGATTGCTTGTTTATCTTAGATGCTAATGAAGGTTACACAGCAAATGAAGCTATTAAAGT
CCTGGAAAAGTTGCATGAAATGGATGTGACTCCGGTGCTATTTGAACAACCTGTTCATAG
AGATGATTGGGAAGGTCTTGGTCATGTCAGTCAGATTGCAAAGGACAAATATGGGGTATC
TGTTGCTGCCGATGAAAGCTGTCGAAGTTTGGTTGATGCTAAAAAGATAGTGCAAGAAAG
TCTTGCTGATGTCATTAACATTAAGCTTGCCAAAGTTGGGGTGCTCGGGGCTCTGGAAAT
TATTGACTTGGTGAGGCCCTCAGGCTTAAATCTAATGATTGGTGGTATGGTTGAAACCAG
GCTTGCCATGGGCTTTGCTGGTCATCTAGCCGCTGGCCTTGGATGTTTCAAATTCATTGA
CCTAGACACACCCCTTCTGTTGGCAGAAGATCCAGTTTTCGGGGGTTATGAAGCTTCTGG
ACCTGATTATAGCTTCTCAAATGCTAGAGGGCACGGTGGTTTTCTTCATTGGGAGAATAT
TGCATGAGATTAGTAGCGGAGCTTGTTCACTCTTCAGGATTGTTACTCACAACGGTCAAC
CCCATTAGTTCCTAATTATAGTTATGCATATGTACTCGTGAGTATTAGTCGTTGGTAAGT
TTGAATGTTTATGTGCCAAAGAATGGAACACAATGCTAGAATATCTAAACTTTAGAGTAA
ACAAATATGTAAACGTCTTATTGTCTTTTGAAATTGGTGTTAGTTGAGAATGTAGTTGAG
AATGTCTTGCTTGATCTTCTCTTTGACAATTTCAACAAATGTTAAATCAATATGCCAGAC
TCTTGGTACTAATTTG