Microarray Probes on PGSC0003DMT400014323

Probe IDChipProbe Sequence
CUST_6571_PI426222305 JHI_St_60k_v1 AACAAGTGGATAGAAATGATGATAATGTTGTAACCGGGCCAAAAGGGCACCATCATGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014323

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014323 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G18570.1 +3 4e-42 145 95/167 (57%) Oleosin family protein | chr3:6396072-6396572 REVERSE LENGTH=166

Transcript Sequence (897 bp)

>PGSC0003DMT400014323 897 pgsc_dm_v3.4
TCTCCCTTTGCTCTCCTCTATTTCACTCTCACTCTCTCTTCCCCAACATTCATACACTCT
TTTCTTTCTCTGCAACAAAAATGGCCGATCAACAACCCAACTACGGCCGTCAACAAAGGC
CACCAACTCGTTCCTCCGGCTTCAACAGCAACATGACTACCCCTTCATTCCTCCGCAAAT
TGCAAGAACACGTCCCTAATTCCACCCAACTCGTCGGATTTCTAACCCTAATTATCTCCG
GCGGAATCTTACTCCTTCTCACCGGACTCACACTTACCGCAATTATTTTAGGTTTAATCT
TCTTCACCCCTTTGGTTCTAATCTCGAGCCCAATTTGGGTCCCTGTGGGTACTGTTCTGT
TTATTGCCATTGCCGGATTTTTATCTGTTTGTGGATTTGGGGTTGCCACGCTGGCGTTTC
TCTCTTGGTTATATAGATACATTAGGGGATTACACCCACCCGGTTCGGACCGGGTTGATT
ACGCCAGAAGCCGAATTGCTGATACGGCTAGCCATGTGAAGGATTACGCTAGGGAATACG
GCGGCTACCTTCATAATAAAGTGAAGGATGCAGCTCCTGGTGCTTGAGCTCAATCGAGCC
GTTTCTATAAGTTTTGTTTGAACCGGGTTAATTTTCTCTTGAGTTTATTTTTTATTTTTT
TTTAATTATATAAATATAAAATCGGACTGTTGTAGTGTTCTGATTTACATAGAATGTAGT
GATGTTTATTTGAGGATTTTAATTTCTTTTATATGGAATTTAATTGGGCCCTCAATAGGC
ATAACAAGTGGATAGAAATGATGATAATGTTGTAACCGGGCCAAAAGGGCACCATCATGT
TTTTTTTTTTGCTCAATTATTTGTTGCACTCAATAATGTGCTTCAAGCTCATCAACA