Microarray Probes on PGSC0003DMT400013020

Probe IDChipProbe Sequence
CUST_8997_PI426222305 JHI_St_60k_v1 GATAGACCCTTGTTGTCCTATTCTTGTTGATTTTTCATTTTTAGGCATGTATTCGACTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013020

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013020 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G61760.1 +1 1e-67 216 110/226 (49%) Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family | chr1:22807440-22808114 REVERSE LENGTH=224

Transcript Sequence (1116 bp)

>PGSC0003DMT400013020 1116 pgsc_dm_v3.4
AGAATCCAATAACACTACTTCTCAAGAAAGTATATTTAATTATATACTAAGATCACATAA
CCAGTTCTTCTTTTGTTCTTTTCTTTCCTAAAAAGTTCTCAACAATACTATGACATCCAA
AGATTTGCATTATATAATAATGTACTCTAAAAACTGTTCATGATCAACCACAATTCCATT
CACTTGAAAAAACAAAAAAAAATGCAGCATTCTAGGCCAGAGTTACCAGTTAATCGTCGC
GATCAAGATCGCCCTGTAAGGCGACACCATAGTGCTAGCTACTATGCCCACTGGGTTAAA
GAAAGTTTAACCACAAGAGTGTCAAAGCTCATATGTGCTATATTCTTAGGCCTTCTTGCA
ATTGTTGGACTCATCACATTCATTTTATGGCTAAGTCTTCGTCCCCATCGTCCACATATT
TTCCTCAATGACTTCTCTATTCCTGCTTTAGGCCACGGAGATGGTGGTGGTGGACCTGAA
AATGCACACATAAGCTTCAGAGTTACAGCAAGGAATTCAAATCAAGGTATTGGAATCTAC
TATGATGCAAGTCAAGTGACGGTGTATTATCGAGAAAAGAGCGTTGGAGGGTACCAAGTG
TCGACAACATTCTATCAACAGCCTAAGAATAGCACCCTGTTTGCTAGTACGCTTAGTGGT
TCATCATTGACATTGACAGAGTCACAGTGGAAGCAAATGCTGCATGATCGGTCGAGGGGG
GCAGTGATTTTTCGTGTTGAATTAGTTTCGACTATAAGATTTAAGATTTCGTCGTGGAGC
AGTAAACATCATAGGTTTCATGCTAATTGTCCCGCTGGACTAGGACAAGATGGCAAGCTG
TTGCCTATTTATATGGACAAGAGGTGTTCTTTTTATTTCTATTGATGAATTAGGAAGGGG
AACATTTATTTATGATATTTTCCATTTGTTGTCCTATTCTTATCACAACAATAACATACC
TAGTGTAATCCCACAAGTGGGTCTAATTAGGGTAGTGTGTACGCACACCTTACTGATTCT
AATAGACCCATAGAAGGTAGAGTGGTTGTTTCCGATAGACCCTTGTTGTCCTATTCTTGT
TGATTTTTCATTTTTAGGCATGTATTCGACTACAAA