Microarray Probes on PGSC0003DMT400012612

Probe IDChipProbe Sequence
CUST_32315_PI426222305 JHI_St_60k_v1 TCAGAGAGCTCTCTGGAAGAGGACAAGACATTTACATACGAATGGATTCTTCAGACATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400012612

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400012612 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27290.1 +3 0.0 847 425/789 (54%) S-locus lectin protein kinase family protein | chr4:13666281-13669202 FORWARD LENGTH=783

Transcript Sequence (2983 bp)

>PGSC0003DMT400012612 2983 pgsc_dm_v3.4
ATTAAAAGGCTTAGGCATCAAACACATAGATGGAATCTAAATACTTCATACTTTTCTTAC
TATCTTTCTACTCTTTTATACCGAAGATTAGTTCTACTACGACAAATGTAATCAATACTA
ATCAGTTCATAACAGATGGTGACACTATTGTTTCATCTGGTGGAACCTTTGAGCTGGGAT
TTTTCAGCCCCAATGGTTCCACAACGCGATATATTGGGATATGGTACAAGCAAATTCTTC
CTTATGTCCAAACAATTGTATGGGTTGCAAACAGAGAGAAACCACTCACCAATACATCTT
CAGTCGTTTTGAAGGTCAACAAGCCGGGAATACTTGCTCTACTTAATGACAAGAATGAAA
CTATATGGTCCACGAACACCTCACGATCAGTCCAAAATCCAGTTGCAGTGCTGTTGGATT
CTGGTAATCTTGTCCTAAAAGATGCAAATGATGACAATCCAGAAAATTTCCTATGGCAGA
GTTTCAATTTTCCAACTGATACTCACTTGCCTGATATGAAACTCGGAAAGAATTTTAAGA
CTGGTATTGAAGTTTACCTTTTAGCATGGAAGAACGATAATGATCCAACTCCAGGGGAAT
ACAGTCTCCACATTGATCCTACTGGATATCCACAAGGCCTCATTAGACATGGGGCAAGGG
TATCAGCTCGAGCAGGACCATGGAATGGTTTACGGTGGAGTGGAGCACCTGCACCACTAC
AAACACAAACCAGCATATATACTTTTCAATTTGTTTTCAATGAAGAGGAGGTTTACTATA
GTTTTTCTCTCATTAACAACTCACTGTTAACAAGGTTAGTCCTGACTAACAATGGTTATA
TACAACGTTTGACGTGGGTGGATAGGACAAAGAGTTGGCATCTTTACCTCAATATTCCTC
TGGATACTTGTGATACATATAGCTTATGTGGTGCATATGGGAGCTGTGTCATAGATAGTT
CTCCTGTTTGTGGATGTTTGGACAAGTTTGAACCTAAATATCCACAAAATTGGCAAACGG
GAGACTGGTCACAAGGGTGTGTTAGGAAGACACCTATTGATTGCAACAAGGAACATGGAT
TTCTAAAATATTCTGGAATCAAGTTGCCAGAAACTAACAACTCTCAGTACAATAAGACCA
TGACACTCGAAGGATGTAGGCAAGTATGCTCAACGAACTGTTCTTGCACAGCTTATTCGA
GCCTAGATATAAGCAATGGAGATAAAGGTTGCTTGTTTTGGTCTGGGGAGTTGATTGATA
TCAGAGAGCTCTCTGGAAGAGGACAAGACATTTACATACGAATGGATTCTTCAGACATAG
TATCTCAGGCAAGTTCAAACAGAAAGAAGACAGGGACAGTACTCGCGGTGAGTTTCTCGT
TGTTGGTGGCAGTGATTCTGCTAGGCCTGATTCTGTTCATGTACATACGTAAAAAGAAGA
AACTAAAACTCAAAGAAGATTTTGAGCTGCCACAGTTTCAATTGTCGTTAATAACAAGAG
CCACAAATAACTTTTCGGTCAACAACCAGATTGGAGAAGGTGGATATGGACCTGTTTATA
AGGGAGTACTGGAAGAGGGACAAGAAATTGCTGTGAAGAGACTGTCAAGGACTTCCATGC
AAGGAATTGATGAATTCAAGAATGAAGTTACCTATATTGCCAAGCTTCAGCATAGAAATC
TTGTGAGACTTCTGGGTTGCTGCATTCAAGGGGAAGAAAAAATGTTGATCTATGAATACA
TGCCTAATAAAAGCCTGGACTCATACATATTTGATCAAACAAAGAAAAAGTTACTTGATT
GGTCAAGGCGTTTCGACATCATTAATGGAATTGCTCGTGGCTTATTGTATCTCCATCAAG
ATTCTAGACTACGTATTATCCATAGAGACCTTAAAGCAAGCAATGTTTTGTTAGATACAG
AAATGAATCCAAAGATATCAGACTTTGGGATGGCTCGAAGTGTTGCAGGAAATGATATGG
GAGCAAAAACATGCCATGTAGTTGGGACACACGGTTACATGTCCCCTGAATATGCAGTAG
ATGGAATCTTCTCAGTAAAATCAGATGTGTTTAGCTTTGGCGTATTGGTGTTAGAGATTG
TGAGTTGCAAGAAAAATAGAGGATTTGTCCATGAAGATCACAACCTTAACCTTCTCGGTC
ACGCATGGAAGCTTTACAAGGAAGATAGGTCCTTGGAACTAATTGATGAGAAGCTAGCTG
AATCTTGTCATATTTCTCAAGTTTTGAGGTCAATTCAAGTGGGACTATTATGTGTGCAAC
AATGTCCTGAAGATAGACCAAACATGTCTTCTGTGGTTCAAATGCTAGGTAATGAGAGTT
TACTGGCAAAAGCTAAAGAACCAGGATTTTTCATGGAAAGAACGCTACATGATTCAGATA
ATTCAGGAATGCAGACAGGAAGTTCGAAAAATGAAATAACAATGACAATGTTAGATCCTC
GGTAGAGTACTGTGAATGAGGCAACTACTGTTGATAAGCATGAGTAACAAATTATTTTAG
AGGGCGTGATAACGACATTGAAGCGCCTGAGAAGCGCTCAAGCATCACCTCAGGGATTAA
GCGTGCCTTTGAGTATTTAGAAAAATGGTTCATAATTGCCATGCTATTATAAGTATCTAT
TCAACTTGAATTTTCATTTGTATCTTATCTTAGAAAGAAATGTAAATTCTAGTAAGCAAA
AATGTCCAAATTATATAGCCTATGATAATACATAAAATCGAATCAAACCGACAGATGCAC
GAGCTCTCCAATATCTGCATGGAAGAGTCCAATATGTCGTTGAAATTAAAGGTCACAAAC
TTTGGATTTCCATATTTGAGTAAAGAGAAGAAGATAGGGAAAAAGGCCATAAGCCCACAT
TGACCGTGCACGGCCTTTCATATCCATCTCCGCCCATAATAAGGGAAAGTAAACTAATCG
GGTATGAATAGATAAGAAAGTGAGATTTGAATCCAACCCGGCC