Microarray Probes on PGSC0003DMT400010274

Probe IDChipProbe Sequence
CUST_3484_PI426222305 JHI_St_60k_v1 GTTGGTAGCGTGGAAGACTTAATAGAATTTCCAAAAGACTGACATTGAGTGAGAATAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010274

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010274 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G42930.1 +3 1e-130 395 223/466 (48%) alpha/beta-Hydrolases superfamily protein | chr5:17210738-17214152 REVERSE LENGTH=467

Transcript Sequence (1843 bp)

>PGSC0003DMT400010274 1843 pgsc_dm_v3.4
AAAATACTTTACTAAAATAATCATCGATCTGCAGTATGGCGAACAATAGTTGCAACAAAT
CTTTCTGCAGCAACTATATGTTGCTAAAGCCACAAGAATGTAGTGTATTAGATTTGGCAA
AAATTTTGTTTTCCCATAAAAGTTTGGGACAAAAAGAATTCGTGGACTGCCCTAATGAAG
AAATGATTAAGGAGCCTTTGTCACGTAGATGGGTTATATTTTTATCCATTCTAGTCCAGA
AGATTTTACTCGCAATTGCTAAACCTTTAGCAGGTTTTGGCAATGCAATTGAGTACTGGC
TTAACCTTCAAAACGTTAATGGCGGCTTCTTCCGTCTTCTTTTCAAATCCTTAATATGTA
AAGCTGTATCACCGGATAAGGAATCAGCGGCGTACTTGTCATTTATTGGAAATCTGGATA
AAAGAGTTGAGCTGGATTTTAGTAAGAATGTTGGAGGACGAAGAAGATATGATGAGGCAA
TCAGCATGATGGCTGCAAAAGCAGCTTACGAAAACAAAGCATATGTTGAAACTACTGTTA
AGGATCACTGGAAGATGGATCTGGTGGGCTCATTTGACTTCTGGAATGATTATCAACAGA
AAGCTACAACACAAGCATTCGTGCTTCAGGATAAAAACGTGGACCCTGAGCTGATTGTTG
TGGCATTTAGAGGAACTGAATTCTTCAATTCTGATGATTGGATCTCCGACTTTAATCTCT
CTTGGTATGACATTCCCGGCATGGGCAAAGTCCATGCCGGATTCGTTCAAGCTCTTGGCT
TACAAAAGAGCCTCGGATGGCCCAAAAATATTGTACAAACTGATGATAATATTAATCACC
CACCTCCAGCCTACTATTTCCTAAGAAAATTGCTCAAACAACTTCTCGAGAAAAATGAGA
AGGCAAGGTTTGTAGTTACTGGTCACAGCTTAGGTGGAGCACTTGCAATTTTATTTCCAG
CAATATTAGCATTCCATGAGGAATCTTGGCTGTTGAAAAGATTAGGGGGCATTTATACAT
TTGGTCAACCAAGAGTTGGAGATGAAAATTTTATTGAGTATATGAAGGGACACTTAACAA
AACATGAGGTTCCATACTATAGAGTTGTCTACAGCAATGACATGGTACCGAGAATGCCAT
ATGACAATTCTACTTTCATGTTCAAGCACTTTGGAACTTGCATCTATTACAATAGCCTCT
ACAGAGAAAAAATTTTAGTTGAAGAACCAGACAAGAATGGCTCGTTTCTGTTACTGTTTA
TACCAAAGATGTTAAATGCAGCTTGGGAGCTGATGAGAAGCTGTATTCTACCATGTGTAC
ACGGACGAAAGTATCAGGAAGGCGGGCTTCTTCTATTCATGAGAGTGGTAGGCTTGCTAC
TCCCAGGCATGCCTGCTCATTGTCCTCAGGATTATGTTAACTCTACCAGGCTCGGATCAT
CTGATCATTCCACTGAAGACGTTGCAAAGTATCAAAAGATTGGCATAGTACCAGCATAAT
TATGAATTAATTAGCTAGCGATCGAGTGTGTGCTTTTTAGAATTTCTTATCCTACGTATT
AGTTTTTCCCTGCACCAATGTAGATATTTAATTGATTTGAAGTTTGAACCGAGTCCTGAA
GATTTCCCCAATCCGATAAGTCTTGAAGATTCACTACATACTTTTGATCTGGAAAAGATC
GTCCAGGTAGTGTGTTCATGTGGACTTCCACAGTATCACTCTTAGAATCCTTTTCATGTG
CCTTCACAAGTTGGTAGCGTGGAAGACTTAATAGAATTTCCAAAAGACTGACATTGAGTG
AGAATAATATATATATTACTAATATATTGCCAGCTATTTGAAA