Microarray Probes on PGSC0003DMT400009552

Probe IDChipProbe Sequence
CUST_7473_PI426222305 JHI_St_60k_v1 CTTGGCTACACAACAACAAAATTGGAAATTGCTCGTTGAATATTCAAATGATGGGTAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009552

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009552 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G06300.1 +2 4e-88 274 155/179 (87%) Putative lysine decarboxylase family protein | chr5:1922042-1925278 REVERSE LENGTH=217

Transcript Sequence (1642 bp)

>PGSC0003DMT400009552 1642 pgsc_dm_v3.4
GTAAAAATGATGAAAAAGTATAGGCGGAAAGTGTATATAAAAAAGGACCAATAATAGCAT
TTTCTTCTCACATCAACATTCCCCTCTTTGCCTCCTCTGCTTAATTCTTCAATTTCAAAG
ATAATTGCTGACTCAAACTCTCTTTTTTCTCAAAAATTCCTTCTGTTCCCCTCTCCCTTT
TTCAATCAAACTCATCGCATCGAATTTGCTTACTACGATTTACGTCACGTAAATAATGGA
AAACAATCACCAGACACAAATTCAGGCCACTAAAACATCAAGATTCAAACGCATATGTGT
TTTTTGTGGAAGCAGTCCAGGCAAAAAGCCAAGTTATCAACTTGCTGCTATTCAACTTGG
CAATCAACTGGTTGAAAGGAACATCGACTTGGTTTATGGAGGTGGCAGTGTTGGCTTGAT
GGGCCTAGTTTCTCAATCAGTTTTTAATGGTGGCCGCCACGTGTTAGGTGTGATTCCTAA
AACTCTTATGCCAAGAGAGATTACTGGAGAAAGTGTTGGAGAAGTAAGAGCAGTGTCTGG
AATGCATCAAAGAAAAGCAGAAATGGCAAGACAAGCTGATGCATTCATAGCCTTACCAGG
TGGCTATGGGACATTGGAAGAACTCCTAGAAGTCATCACTTGGGCTCAACTAGGCATTCA
TGATAAACCAGTAGGTTTACTTAATGTAGATGGGTACTATAATTCATTATTGTCATTTAT
AGACAAAGCTGTTGATGAAGGCTTTGTTACACCCTCTGCCCGTCACATCATTATTTCTGC
CCCAACTGCCCAAGAACTCATGTCTAAGCTTGAGGTACAACTCATCATTCATCATGCCCG
TTTGGCGCGATATTATTATGCATCTACTGACTTAAAATCTTGAACTCATGATTCCTCATG
CCCATGTAAGCGACATAATGCATTCACTGATTTAAAAGAACTCCTGAATCATTATGATGA
TATTGTGCATCTGTTGACTTAAAATTTTGAAATCAACATCTCGAATTTACTATTCATGAT
TCATCGCGTACATATGACGATACTATTTATTTACTGACTTAAAATCTTGAATTAGCCCTT
TTTACATGTTGAATGGTTTTTATTTATAGGATTATGTCCCAAAGCATAATGGGGTGGCAC
CAAAATTGAGTTGGGAAATGGAGCAACAACTTGGCTACACAACAACAAAATTGGAAATTG
CTCGTTGAATATTCAAATGATGGGTAGATTTAATATATATTTATAGAGAAAAATGTAGTA
AATTTCTTTGAAGACTTAAATTCATCGATTATGACTTAATTACCATAAGGTAAGATGTTG
ATGGGAAAAAGCTTCAGAGAATTAATTAATATAATTAGTAGCTTTACAGCAATTTTAACT
TGCTGTTTATAATTAGTTGCAAGGGGAAAAAAAATTACGTACTAATTTGTTTAGTGTTGA
TTCATTTTTGTCCATTAGGCTAATCAAATGCCTAATTAAAACAGGAAAAAGTTGATGTAG
TACAAGTAATTGTTTTTTTTTCTGTCTGTATATGATTGTTTGGTAATGTACATTAATTTC
TTTGTTATTCTATAGTTAATTGTGTTTACTCTAATGTAAAACGTGTAAGCTTATCTTATG
AAATGAAATATAAATATATTTT