Microarray Probes on PGSC0003DMT400008327

Probe IDChipProbe Sequence
CUST_17476_PI426222305 JHI_St_60k_v1 GCCCTGTTTTTGCTCTTCTTTAATTCCTCCCAGCTCACGATCTTTGAGTTTGGGTTTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008327

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008327 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G10610.1 +2 1e-127 381 197/268 (74%) CTC-interacting domain 12 | chr4:6557336-6559143 FORWARD LENGTH=336

Transcript Sequence (1699 bp)

>PGSC0003DMT400008327 1699 pgsc_dm_v3.4
ATTATCCTTTTTCTGTAGACTCAGTAAAATAATACATCACTCCAAAGAAAAAGAAAAGTC
TTGCCCTGTTTTTGCTCTTCTTTAATTCCTCCCAGCTCACGATCTTTGAGTTTGGGTTTT
GTTTTTTTGATTAATGGAGACCATTTAGAGTATCAGAACCCGAATTTGGGAAAAAGGGTT
AAGGAAGAAGGAGAAAAAGGAGCAGTCTTGGGTACTGTGATACATAGTTGTTGCTGAAGG
AACAATCATGGCCGTGGATGAGAATGGCTCCTTGAATCGGACGGACGATAGTGCTGTAAA
GAATGATTCCGCTGCCGTCGATCAGAACGGTGCGCCACGGTCAACGATACCCAGTGATCA
GGATATTCAAATGATGCCTGTTGATCATCAACCCCAGAAAACGAGTTTGCAGCATAAGCC
TCAAATGGGTGTTTTTCAACAGCAGAAACAAAGCATCAACGGCAATGGAGTGATGAGTCA
GCATAATTTTCAGACTCAGCATCAGAAAATGAACGGTGTTGATTTGAGAAGAAATGGAGG
GGTTGTTGATGAGGATGAAGATGGGGAAGGGTTTAAGAAGGAGATGAGGGATTTGGAGGA
AATGCTTTCCAAATTGAACCCCATGGCTGAAGAGTTTGTGCCTCCTTCACTCTCTAGCAA
CCACGGAGTAGTGCCAATCTCTCCTGGTGGAGAACAATTTGGGTTTGATGCTTTCAATTT
TGTAATGCAAGCTGGACTCAGCGATGGAAATTTCAACAGAAGGAAGAGAAATGGCTATGG
TCTTGGTAGGAGACGGACAAATGTCCGGACAAGCATGGCCCAACGTGAAGATGTTATAAG
GAGGACAGTTTATGTGTCTGAAATTGATCAACAGGTGACTGAAGAGCAACTTGCTACACT
CTTTCTTACTTGTGGGCAGGTGGTTGACTGTCGCATATGTGGAGACCCCAATTCTGTACT
CCGTTTCGCCTTTATTGAATTTACTGATGAAGAAGGTGCAAGGACCTCTCTGAGTCTTGC
AGGAACTATGCTAGGGTTTTACCCTGTGAGAGTGCTTCCTTCTAAAACTGCAATTGCACC
AGTTAATCCAACATTTCTTCCAAGGTCTGAAGATGAAAGGGAGATGTGTGCAAGAACTAC
ATACTGTACAAACATTGATAAAAAGGTTACTCAAGCAGATGTCAAGCTCTTTTTTGAATA
CTTTTGTGGAGAGGTTAAGCGCCTGAGGTTACTTGGTGACTATCATCATACTACTCGTAT
AGGTTTTGTCGAGTTTGTTATGGCTGAGAGTGCCATTGCTGCACTGAACTGCAGTGGTGC
AATCCTGGGATCTCTTCCTATAAGAGTAAGCCCATCAAAGACTCCTGTTCGACCACGTGC
TCCTCCTCGCTCCCCTGTGCAGTGATATATCACTTTGCGCTCCTCCTCTGATCTTATTAT
ATATAAATACATACGTAGATACAGATACCTCGTGGCATTTGTCTTTTAGTTTATTTGCAT
TACTCAGCCGGGCATCTCTGACCTTGTTCTTAAGCTTGCACTGTTGGCTGTCTGGTTTAT
GAATTCGTATGTTGATGTAGTTTAAGTTTGGTATATTTATGATCCTCTAGGCAATGCCTC
GAGTACCATTACTGACTGATGTTCTAACTGTGACATTGATCCAATGAGTTCCTTGATATT
CGGCTATCACATTGGTTTG