Microarray Probes on PGSC0003DMT400006724

Probe IDChipProbe Sequence
CUST_9434_PI426222305 JHI_St_60k_v1 TTTGTATTGGCCACTTAACATCTTATGTGTAATTCTGACCCATTGGGTCAGCACGGGCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006724

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006724 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79750.1 +2 9e-103 318 183/231 (79%) NADP-malic enzyme 4 | chr1:30007655-30011179 REVERSE LENGTH=646

Transcript Sequence (938 bp)

>PGSC0003DMT400006724 938 pgsc_dm_v3.4
CTTTGTGTAGACTGGAGCCCCTCTAGAAGAGACACGAAAGAGAACCTGGATGGTGGATTC
TAAGGGGTTGATAGTTAGGTCTCGTATGGAGTCACTTCAACATTTTAAGAGGCCCTGGGC
TCATGACCACGAGCCAGTAAAAGAACTGGTGAATGCTGTGAAGTTAATTAAGCCAACCGT
CTTGATTGGGTCTTCTGGCACTGGGAAGACGTTTACTAAAGAAGTGGTACAAGCTATGGC
AACCTTCAATAAGAAACCAGTTATTTTTGCTCTCTCCAACCCAACATCACAGTCTGAATG
TACTGCTGAAGAGGCTTATACATGGAGTGAAGGGCGGGCCATTTTTGCTAGCGGGAGTCC
ATTTGCTCCAGTTGAGTACAAGGGGAAAGTTTTCGTGTCTGGTCAGGGAAATAATGCATA
CATCTTCCCTGGTTTGGGTCTGGGACTTATAATATCTGGTGCTATTCGTGTTCATGATGA
CATGCTCCTGGCAGCCTCGGAAGCTTTAGCAGCAGAAGTAAGTCAAGAGAACTTGGAGAA
GGGACTAATATACCCACCATTTGCCAACATAAGGAAGATTTCAGCTCACATTGCTGCCAA
AGTAGCTGCCAAAGCATATGAGCTCGGCTTGGCCACTCGTCTACCTCAACCGGAGAACCT
AGTAACATATGCTGAGAGTTGCATGTACAGTCCAAGTTATCGTAGCTATCGCTAAGTCAA
GGAAGATACATAAAATTAGTAGTCATTGATTTTCATAGCTTTGAAGATTAGTGTACTCAT
GGAGATGGTACTAATTTAGGAATATATAGATAATTTTTAGTTTTGTATTGGCCACTTAAC
ATCTTATGTGTAATTCTGACCCATTGGGTCAGCACGGGCCACTGGTCCTCACTCCTTGTA
CTGATGTTTAGCTAATATAAAATAAATAAATTTTACGT