Microarray Probes on PGSC0003DMT400006611

Probe IDChipProbe Sequence
CUST_9513_PI426222305 JHI_St_60k_v1 GCAGATCAAAGATCTTACTTATCCTGGACAAGTATATTGAGATTTCGAAGAAAGAGTAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006611

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006611 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G72770.1 +2 2e-161 498 291/590 (49%) HYPERSENSITIVE TO ABA1 | chr1:27390998-27392851 FORWARD LENGTH=511

Transcript Sequence (4179 bp)

>PGSC0003DMT400006611 4179 pgsc_dm_v3.4
GGCTGACCTGCCAAGAAAGGACACGTGTTGTTCTTGAAAATGGTCCTCATGGAAAGTCCA
TGAACTCCCTTTTGTTTTTTTGTAATTAAGGGTAAGCGCAAAACAATTCAAAGCATTTCT
CTGTCTGCTAGCATTGATTGGAGTTAGATAATTGAATCTACACGTGTCTTCTAAGGAGTC
AGTGCATCAAAGGTAAAATCTTTTCTACATCCCAAGTTGTATTTTCTCTCTCATGTGTCT
CACAAAGAAAAAAAATAAAATCTTGAAAAGGGGCTGTAGAGGGAGAGTCTGCAAGGTGTT
TTGGTAAAAGGGTTTTTGTTGGTAAGCTTAATTATTACTGTTTTAGTTGAATTTATTGTA
AATAGGACTGTTTTTTTTTATGTTCTTGAATGGTTTGTTGCTTAAAGATTCAATTTTTAT
CTGTTGGGTTGGAGGAAGAAGGAGAGTATATTTAGTAAATGACCTGTATTTTGAGAGGTG
GACATGAGTTGCCTCAGATCCATGAAACCCAAGTTACATGTGGCAAAAAGGTAGTATCGT
TTTAGGGTTTTTCTTGTGATTCTTGATTAGTTGTCTGTTTTCTTCTCCTTACTAGGTTCT
TTTCCATGATTCTTTCGCTTTCTCTTCTTGAATTCATGGATAAGGGTTTGATTTTGTCGT
TTTCCCCATTTTCTTGTGTATTTAAGGGTTGGTGGTGGTGGAGCTAGGATTTGCTCTACT
TAATCTTGTTTCTTCTTTTGAAGAAAGATAATTGCATGATATTTTAGTTTTAGGTACAAG
AAAGGACCCCCTAAGTCTTCTCAGTCTAGAACTTGCCATCTATAGAAGTTTGGATCTGTT
TATAGTAGCAGATCTCCTTCACACCCTTGTTTGTTTCACTTATCTGGAGCTTGTTCCACC
TATTGTTTGATGTTGGTAGTGTACCCTTTACTACTTGTAGTGAGCTGTTGACTGAGATCT
TCTTGCCTCATTCAATTTTTGTCTCTCCTCATTTTTTGTGTATTCCTACCTCATTCTCCT
TGTGCTTATAATTTAGCTGTCTTGCCCATTTTTGTGGATTCCTACCTCATTTCATTGTGG
ATTCAATTTAGCTATTTTACCGCACTTGTGAATTCCCTTCTAAAGCAGTCCTACTCTGTG
AAACATAAAGCTTGGAACAATTTGTTGCTGGTAGTGCTGCACGGACTAACGCGGTTGACT
CAATTGCATATTGTTTTCACTAGAAGAATTAATGGAAGAGATGTCTCCAGCTGTTGCTGT
TACACTCAGCTTAAGCAGCTCTATCTGTGATAACCCTGCAATTTCGAACCATGTAGAAAT
CACAAGGCTCAAATTAGTGACTGACACAGCTAGCTTACTTTCAGATCCTGCATCTTTGTT
GCATGCTGAGTCAAATACCAGTTGGAATGGAAATAGCAACGGTATGAAAGTTGGCGTTGG
TAGGATTCCCTTGTTGACACTAGGAGAAAGCTCTGGAAAATGTAGTCTGCCGCAGACTCT
ATTGGGAGCTGAAAACGGCCTGATTGTTAGCGATAGCATCATTCAGGGAAGTGATGAAGA
TGAGATTTTATCTGTTGGAGAGGATCCATGTGGAATTAATGGCGAGGAGTTGTTGCCACT
GGGAACTAGCTTACAGTTGAGCTTGCCAATTGCTGTTGAAATCGAGGGTATTAACAATGG
ACAAATAGTTGCCAAGGTCATAAGTTTGGAAGAAAGGAGTTTTGATAGAAAGGTTAGTAA
TACCATAGTTGCTCTCCCAGATGATGAAATTACTAGTGGCCCTACACTAAAGGCATCTGT
AGTGGCCCTTCCATTGCCCAGTGAGAAGGAGCCTGTCAAAGAAAGTGTCAAGAGTGTGTT
TGAATTGGAATGTGTGCCACTCTGGGGTTCTGTATCTATCTGTGGAAAGAGACCGGAGAT
GGAGGATGCTCTTATGGCTGTTCCTAATTTTATGAAAATTCCTATCAAGATGTTTATTGG
TGATCGTGTTATTGATGGACTAAGTCAAAGTTTGAGTCACCTGACATCTCATTTCTACGG
AGTATATGATGGTCATGGAGGATCTCAGGTTGCAGATTATTGCTGTAAACGTGTTCATCT
AGCATTAGTTGAGGAGTTAAAACTTCCCAAACATGATTTGGTGGATGGAAGTGTAAGGGA
TACCCGGCAGGTTCAGTGGGAGAAGGTCTTTACTAATTGCTTTCTCAAGGTTGATGATGA
AGTTGGAGGAAAGGTGAACATAGATCTCTGTGATGACAACATGAATACCTCTAGCTGCAC
CTCTGAGCCTATTGCCCCAGAAACTGTTGGGTCCACTGCGGTTGTAGCGGTGATTTGTTC
ATCTCATATTATAGTTGCTAACTGTGGGGATTCAAGAGCAGTCCTTTATCGTGGCAAAGA
AGCGGTGGCATTGTCAATCGATCACAAAGTAAAACACACTTTAGCATCAACCTCTTGTTC
TCTTTTTTGTTCTTCTCTTCCTTTTTTTCACATACATGTGTCTAATTTTGGCAGGAAAGA
ATGTGGTTGATGCATTACCATCTCACTCTTTTACCTTGTATTCTTTTACCAGCCAAGCAG
AGAAGATGAGTATGCCAGAATTGAAGCATCTGGTGGTAAGGTCATTCAGTGGAATGGGCA
TCGTGTATTTGGTGTTCTTGCAATGTCAAGATCTATTGGTGACAGATATTTGAAACCATG
GATTATACCCGAACCAGAAGTTATGTTTGTACCACGTGCTAGAGAAGATGAATGCCTAGT
TTTAGCCAGTGACGGATTGTGGGATGTGATGACAAACGAGGAAGCTTGTGAAGTGGCTAG
ACGACGAATTCTGCTGTGGCACAAAAAGAATGGGACTAACTCTCTGCCGGAAAGGGGCCA
GGGAGTGGATCCTGCTGCACAAGCAGCGGCAGAGTATCTTTCATCGATGGCTCTTCAAAA
AGGTAGCAAAGACAATATATCTGTGATTGTGGTGGACCTTAAAGCTCACAGGAAATTCAA
AAGCAAAAGTTAGAGATTACATGTTCTCACCCACATTTGGTTTAGTATAAATCTGTACAC
GGCGACGGGTATAAATCTCATTATTACATAACTCAGTCCATTCATTTTTCCTATGGGCTT
AAGGTGTGTATGAGAATAGTATTTTAGCAATGTATTATAGAAAAAAACAGTTAACAAACG
ACGTTTATCCAAATTTTTTGGTGTTTGTTGCGCCAGAAAATGGCTATGTAAATTGAGCAT
GTTGAAGCAATATCAGAGGTGCAATTTCTTAATTCTTCCGTTCAGTATAAAAGCAAAGAC
ATTATTGGTTACTTGATAAGTTATGCACATTGCGGGTCTCATGAGGATCTATGAGGTTGA
AGGGCAATTCGATTCATTAAGGGGGCATAGTGCTGCTGTGGTTTCGGACTTAGCAAGGTC
TAAGGGCCATTCGATTCATTAAGGGGCGTAGTGGTGCTCTCAAGCGGTTTCGGACCTAGC
AGCATACAAGTGGGTGATGCTCTCAAGCGGTTTCGGACCTAGCAGCATACAAGTGGGTGA
TGCTCTCAAGCGGTTTCGGACCTAGCAGCATACAAGTGGGTGATGCTCTCAAGCGGTTTC
GGACCTAGCAGCATACAAGTGGGTGATGCTCTCAAGCGGTTTCGGACCTAGCAGCATACA
AGTGGGTGATGCTCTCAAGCGGTTTCGGACCTAGCAGCATACAAGTGGGTGATGCTCTCA
AGCGGTTTCGGACCTAGCAGCATACAAGTGGGTGATGAATTGAATTAGCTAATGAATCTT
TCGTAATGCTTGCAAAGAAATCAGAAGAAAGGCTTCTGCCCCTTGGTGTTTCGGAACGAA
TGGGAAGAAGGAATCAGAAATGAACTTATATAAGAGCGCTTATTCCGCTTCCTTCTACTC
TTGAAAGGTGATGCCTAAATTGACAACGGATTAAACTCTGCTGAGGAATTCTTTTATTTG
TCCTGGACAAGTACGTAGAAGCTTGGGCTGCTTTAACCGTTTAGCCATGCAGATCAAAGA
TCTTACTTATCCTGGACAAGTATATTGAGATTTCGAAGAAAGAGTAGAAAAAAACATAGC
AAGGGAAGTGTGAGGAGGGAGAGAGAATTTAACGTGTTAAAACAAACCATGTAACATAAA
TATGGAATCCAATTATCAATGGTTAAATCATCACTTGTA