Microarray Probes on PGSC0003DMT400003939

Probe IDChipProbe Sequence
CUST_5034_PI426222305 JHI_St_60k_v1 GTTGTTGTTGAAATCTATTATTGTTTCCAGTCATGTTCTTGGAGCATATGCTAGTTTCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003939

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003939 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G04530.1 +2 8e-24 101 72/181 (40%) Tetratricopeptide repeat (TPR)-like superfamily protein | chr1:1234456-1235895 REVERSE LENGTH=310

Transcript Sequence (1476 bp)

>PGSC0003DMT400003939 1476 pgsc_dm_v3.4
AGCTGAGGGTCTACGGAAACAGCCTCTCTATCCCACCAAGGTGGGGGTAAGGTTTGGGTA
CATCTTACCCTGCCCAAACCCCACTTGTAGAATTACACCGGATATGTTGTTTTTTTGGTA
ATAACATGTGAAACCGGATATGATGTTGTTGTTGAAATCTATTATTGTTTCCAGTCATGT
TCTTGGAGCATATGCTAGTTTCCTCTGGGACATCAATGACGATGAAAGTGAGGATGAAAT
GAACACACAGAGTGATAAGACTAAGATTGAGGAAAGTGGGGAAGCTACTGTATCCCGGAA
CTTAGATTACGAAGAAGCTAACAGACCTGTTAGTCCTCCCTTACATCTTGCAGCAGGATT
AGGAATTGGGGTTAATCTAGTTGGTGGTGGCTCTCCTGTTGATTATACTGCAGCTGTATC
TGATATGGACAGAAATGCCGAGGAGGAGTACATGAGAATGATCAAAGAAAATCCTCATAA
CCCCGTGCTTTTAAGAAACTATGCTCAGTTTCTTAGTCAGTCTAAGGGAGACCTACTAGG
TGCTGAAGAATATTACTCACGCGCAATACTAGCGGATCCTACTGATGGAGAAACTATTTC
ACAGTATGCCATGTTGATATGGCAACTTCATCGGGATAAAGATAAAGCCTCAACCTACTT
TAAGAGGGCAGTTCAAGCTTCTCCAGAAGACGGGTAATATTGAATTGAAGCCCCTCATTT
TTTTATTCGCAACATTTAGAATTAAAAGTAATAGCGGTAACTTAATAACCTAAGCACATT
TCCTACTTCGTCAGTTACTAAGACGGTTTAACAGATTTATGTGATGTGTAAAGGAAATCT
GCTACTATTTGATAGCATTGAAAAGGTTAATGAGAAAAGATACAAATATAAGGTTGTTGG
TAACTTGGTATTATGCGAATGTATTGGTGGGAAAATATTAAAATTTTTGGTGATCTTTGG
TATGATGTCAAATCATTTGTGCGTTGCGTTTAAATTAGAAATTGTGTGGTTGCTACTTGC
ACATCTAGTTCATTGTTCTCATTGTTTGGGACTCTGAGTTACTAGCTTGCTTTTTTGCTT
TTCAGCGACGTGCTTGCTGCATATGCTAGATTTCTCTGGCAAACGGAGGAAGATGAAGAC
GGAGAAGAAGATGAAACATTAGGTGATCACAACGGTGCACCACCTTTGCAAGGAGTCATG
GCTGCAAATGCCTAAATCCTGATGTCAAATGAATTCACAATCCAGCTTCCAATTCTTAAT
TTAATTTTAGTTTCTCAAGCTTTTCGCGTTATCTAAAGACTTGGAGCTTTCTCTTGTTGT
GGAGGATCAAGCATTGTGGGAAATTTTTTAAATGGTAAATGTTGTTTAGTGAGCAATAAA
ATGTGAACACTAATGTTAAATTGACCTTGTACAATGTTCTTTATGGGAATAATATGAAGA
AGTTGATTAAAAATTTAAATGGAGACTTCACATTGT