Microarray Probes on PGSC0003DMT400003477

Probe IDChipProbe Sequence
CUST_1383_PI426222305 JHI_St_60k_v1 TGGTGAAACTACTGAGTTTCTTAAACTTGGTCCAAGTTTCATGAAAAACCAAAGAGCCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003477

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003477 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g089160.2 +1 0.0 905 439/453 (97%) genomic_reference:SL2.50ch02 gene_region:45622003-45624825 transcript_region:SL2.50ch02:45622003..45624825+ go_terms:GO:0004497 functional_description:Cytochrome P450
TAIR PP10 AT5G38970.1 +1 0.0 660 312/448 (70%) brassinosteroid-6-oxidase 1 | chr5:15594935-15597774 REVERSE LENGTH=465

Transcript Sequence (1680 bp)

>PGSC0003DMT400003477 1680 pgsc_dm_v3.4
CACGCTTGGCTAACTATTATGACTTAAAGTTCTCTCTTGTGAAGTATAGTAAAAGTAAGG
AAGTCCATACCATTTAGACTACTCTCTGTGAGGTGGTTGGTAACTTCTTTTGAATTTTGA
GCTGCATCAATGGCCTTCTTCTTTGTTTTCCTTTCTTCCTTTTTTGGCCTATGCATCTTT
TGTACTGCTTTATTAAGATGGAATCAAGTCAAGTATAACAACAAAAACTTGCCCCCTGGT
ACTATGGGTTGGCCACTTTTTGGTGAAACTACTGAGTTTCTTAAACTTGGTCCAAGTTTC
ATGAAAAACCAAAGAGCCAGATATGGGAGTTTTTTCAAATCACACATACTTGGTTGTCCA
ACAATTGTTTCAATGGATCCAGAACTGAATAGATATATACTTGTGAATGAGGCAAAAGGA
CTGGTCCCAGGATACCCACAGTCTATGCTAGATATTTTAGGTAAATGTAATATTGCAGCT
GTCAATGGTTCAGCTCACAAGTACATGAGGGGTGCATTGTTATCTCTAATTAGCCCTACA
ATGATCAGAGACCAACTTTTGCCCAAAATTGATGAGTTTATGAGATCCCACTTGAACAAC
TGGGATAATAAAGTTGTTGACATTCAAGAAAAAACCAATAAGATGGCATTTCTATCATCG
TTGAAGCAAATTGCTGGGATTGAATCTACCTCTTTAGCTCAAGAATTCATGCCTGAATTC
TTCAATCTAGTACTAGGAACTCTTTCACTACCAATCAATCTTCCCAACACCAACTATCAT
CGCGGATTTCAGGCAAGGAAAATTATTGTGAACTTATTAAGAACACTAATTGAAGAGAGA
AGAGCTTCGAAGCAAATTCAACACGATATGCTTGGTTATCTGATGAATGAAGAAGCAAGT
CGATTCAAATTAACAGATGATGAGATGATTGATTTGATTATAACTATTTTGTACTCTGGC
TATGAAACTGTTTCCACTACTTCTATGATGGCTGTTAAATATCTTCATGATCATCCAAAA
GTTCTTGAAGAACTCAGAAAAGAACACATGGCTATTAGAGAAAAGAAAAAACCTGAGGAT
CCTATCGATTACAACGATTACAAGGCAATGCGGTTCACACGAGCTGTGATTTTAGAGACC
TCCAGGCTAGCAACAATAGTAAATGGGGTTTTGAGAAAAACAACTCAAGATATGGAAATA
AATGGGTATATCATTCCTAAAGGATGGAGAATATACGTATATACGAGGGAGTTGAATTAC
GATCCAAGACTTTATCCTGATCCATATACATTCAATCCATGGAGATGGATGGATAAGAGC
CTGGAACACCAAAACTCATTTTTGGTATTTGGAGGTGGTACTAGACAATGTCCTGGAAAG
GAACTTGGTGTAGCAGAAATTTCTACATTTCTTCATTACTTCGTAACAAAATACAGATGG
GAAGAAGTAGGAGGAGATAAACTGATGAAGTTTCCAAGAGTTGAAGCACCAAATGGTCTA
CGGATTAGAGTTTCAACTCACTAACTATCAATTCATGAATGTACAGAGCAAAAAAAATGG
AGAGATTTGTAGGATGCAAAGCTAAGAGTAACATGGGATGTACAACTTAATTATTATTCC
CGCTAACATAATCACGAATTAAACACAATTTTTTCTCAGAGTTTATCAATCTTATACGGT