Microarray Probes on PGSC0003DMT400003465

Probe IDChipProbe Sequence
CUST_1316_PI426222305 JHI_St_60k_v1 CCCTATTTCATAACCCCATTGTTTGACGACGTCAACTCTTTTATGGAATGTCTTATAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003465

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003465 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g089090.2 +2 1e-93 298 156/246 (63%) genomic_reference:SL2.50ch02 gene_region:45568082-45571263 transcript_region:SL2.50ch02:45568082..45571263+ go_terms:GO:0004672 functional_description:Pto-like, Serine/threonine kinase protein, resistance protein
TAIR PP10 AT3G51550.1 +2 9e-72 239 132/246 (54%) Malectin/receptor-like protein kinase family protein | chr3:19117877-19120564 REVERSE LENGTH=895

Transcript Sequence (884 bp)

>PGSC0003DMT400003465 884 pgsc_dm_v3.4
ATTTTGCTGTATAGGTACCAAACATATGATCATTCATCGAGATGTCAAGTCAACTAACAT
CCTATTGGACGATAAATGGGTCGCCAAGGTGTCCGATTTTGGATTGTCCAAAGTAGGTTC
AGTAGGTGGGACAGATATTACCCATGTTAGCACTGCAGTGAAAGGAAGTTTTGGGTATGT
AGATCCTGAATACTACAAGCGCCAACGATTGACAGTAAAATCAGATGTTTATTCTTTTGG
GGTGGTTCTATTTGAAGTGTTATGCGCTAGACCGGCAATAAATCCAAACTTGCCAAGTGG
GCAAGTGAATTTGGCTGAGTGGGCTAGTAGGAGTTGTAAAAAGAGAGAACTTGAAGAAAT
TATTGATCCTAACTTGAAAGGACAAATAGCCCCAGAATGCTTAAGCAAGTTTGCAGAATT
GGCATATCATTGTTTGAGAAAAGAAGGGGTTCAAAGGCCATCAATGGGTGATGTTGTAAA
AACTTTAGAATCTGCATTACAGGTTCAAGAGGGTGAAGATCATGAGGTGGAAGGATCCTC
TTTTCCGTTGATTATTAATGGTGATGCTATGAATGAAGATGAGATATTCTCAGATTTAAG
TGAAGTTGAAAGAAAATTGACAAGCAATGGTATATCCATGTCGGTCAGTAGGAGTGCCAA
AGTGAACAATGTTGCCCTTTTCTCTGAGATTATCACTCCATTGGGTCGATGAAATTGTTA
TGATCATAGTTCGATACACTGAAATTACATGTATTTTAATTTGTTTTTCAGCTTCTTTTT
GCAATTTAATGGGTACATACATGGCCCCTATTTCATAACCCCATTGTTTGACGACGTCAA
CTCTTTTATGGAATGTCTTATAAAAAATATTTCTTAAATCACTT